Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for N 5 Trimethoxysilyl 2 Aza 1 Oxopentyl Caprolactam since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... 5 × 10-5 M 2-mercaptoethanol (Gibco, 31350-010), 1X Minimal Essential Medium (MEM ...
-
bioRxiv - Cancer Biology 2020Quote: ... 100 μl of N-methyl-N-trimethylsilyl trifluoroacetamide (MSTFA, Pierce) with 1% trimethylchlorosilane (1% TMCS, Thermo Scientific) was added to react for 30 min in 60°C ...
-
bioRxiv - Microbiology 2021Quote: ... with SARS-CoV-2 N-specific primers (EV Table 1) on a QuantStudio 6 Flex thermocycler (Applied Biosystems). Standard curve was performed in parallel using purified SARS-CoV-2 viral RNA ...
-
bioRxiv - Bioengineering 2022Quote: ... in IMDM/F12 medium supplemented with 1% (v/v) N-2 (Thermo Fisher Scientific, catalogue no. 17502-048), 1% (v/v ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2-NDBG [2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose] (N13195) were purchased from Invitrogen. Recombinant murine SCF (250-03) ...
-
bioRxiv - Immunology 2020Quote: ... 2-mercaptoethanol (2◻×◻10-5 M, ThermoFisher), penicillin (100◻IU◻per ml ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Biophysics 2024Quote: ... USA) dissolved in ethanol or 1μL 2.5mg/mL N,N-Dimethyl-6-dodecanoyl-2-naphthylamine (LAURDAN; Thermo Fisher, USA) dissolved in dimethyl sulfoxide to label the EVs ...
-
bioRxiv - Immunology 2021Quote: ... and reaction was stopped with 2 N sulfuric acid (Fisher Scientific). Optical density at 450 and 620 nm was captured with SpectraMax M2 (Molecular Devices) ...
-
bioRxiv - Developmental Biology 2021Quote: ... were supplemented with 0.5x N-2 supplement (ThermoFisher Scientific Cat. 17502048,), 0.5x B27 supplement (ThermoFisher Scientific Cat ...
-
bioRxiv - Genomics 2024Quote: ... 1X N-2 Supplement (GIBCO/ Thermo Fisher Scientific; Cat. No. 17502048), 10 ng/mL NT-3 (PeproTech ...
-
bioRxiv - Neuroscience 2024Quote: ... 2mL of neural medium with N-2 supplement (Life Technologies, 17502048) with supplements BDNF (20 ng ml−1 ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated with primary antibody O/N at 4°C (5% FBS, 0.5% Tx, 0.2% gelatine in PBS; GFP (1:500, ThermoFisher Scientific). Slices were then repeatedly washed with PBS-0.5% Tx ...
-
bioRxiv - Cancer Biology 2021Quote: Glucose uptake experiments were performed using 2-NBDG (2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose) (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Glucose was traced using 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Invitrogen, ThermoFisher, cat. #N13195) combined with 0,57 mg/mL 40kDa tetramethyl-rhodamine Dextran (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: In vivo labeling of tumor-infiltrating T lymphocytes (TILs) with 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino)-2-deoxyglucose (2-NBDG, Life Technologies, catalog: N13195) was done by intravenous (retroorbital ...
-
bioRxiv - Neuroscience 2022Quote: ... iAstrocyte differentiation was initiated by switching the medium to astrocyte medium (DMEM/F12+GlutaMAX, 1% N-2 supplement, 1% fetal bovine serum, all from Thermo Fisher Scientific) as previously described [81] and continued for at least 60 days ...
-
bioRxiv - Neuroscience 2024Quote: ... All cultures received N2 medium from d0 to 11 (50% MACS Neuromedium, 50% DMEM/F12 containing 1% N-2 supplement [Thermo Fisher Scientific, #17502048] 1% GlutaMAX [Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... N-(5-Anilino-2,4-pentadienylidene)aniline hydrochloride was purchased from Acros Organics. All other reagents were purchased from Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... Mice (n=5) were depleted with anti-mouse CD4 (Fisher Scientific 50561964) and anti-mouse CD8 (Fisher Scientific 50562192 ...
-
bioRxiv - Plant Biology 2021Quote: ... 100 µL of N-Methyl-N-(trimethylsilyl)trifluoroacetamide + 1% trimethylchlorosilane (MSTFA + 1% TMCS, Fisher Scientific, Ottawa, ON, Canada) was added and vials were incubated at 60 °C for an additional hour ...
-
bioRxiv - Cell Biology 2022Quote: ... calnexin (1:1000, Santa Cruz, Cat. N. sc-46669, TSG101 (4A10) (1:500, Invitrogen Cat. N. #MA1-23296) After incubation ...
-
bioRxiv - Microbiology 2020Quote: ... 20 μl RNase A/T1 mix (2 μg μl−1 / 5 U μl−1, Thermo Scientific) was added to 100 μl lysate (OD260 ~ 150 ...
-
bioRxiv - Developmental Biology 2021Quote: ... with 50-100 nl of 1 mM 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen) at stage 41 ...
-
bioRxiv - Biophysics 2022Quote: ... NPE-caged ATP (adenosine 5’-triphosphate, P3- (1-(2-nitrophenyl ethyl) ester) (Invitrogen) dissolved in attachment buffer was photolyzed in the AFM chamber using an UV light source at 340 nm ...
-
bioRxiv - Cell Biology 2022Quote: ... (B-5-1-2 coupled to Alexa-488, Thermo Fisher or DM1A, Sigma), rat anti-tyrosinated tubulin (YL1/2 ...
-
bioRxiv - Neuroscience 2024Quote: ... the cells were pulsed with 1 mM 5-Ethynyl-2’-deoxyuridine (EdU, Invitrogen) for 3 hr ...
-
bioRxiv - Immunology 2024Quote: ... Alexa Fluor 488 anti-mouse/human ɑ-tubulin (B-5-1-2; Invitrogen). Collagen gels were rinsed with PBS prior to imaging by confocal microscopy.
-
bioRxiv - Physiology 2022Quote: ... 60 μL of N-methyl-N-trimethylsilyltrifluoracetamide (MSTFA with 1%TMCS, ThermoFisher Scientific #TS48913) was added automatically via the auto sampler and incubated for 30 minutes at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... and 1 mM N-acetylcysteine (Fisher Scientific). 5 µM DAPT was added for the last 24 hours.
-
bioRxiv - Microbiology 2024Quote: ... 1-N-phenylnaphthylamine (NPN, Thermo Fisher Scientific) was used as described previously 81–83 ...
-
bioRxiv - Bioengineering 2022Quote: ... formalin-fixed fibrotic capsule tissue samples (n=2 per group) and subcutaneous tissue samples (n=2) were placed in a solution of 2 mg/ml FITC (Invitrogen) in DMEM/F12 media (Gibco) ...
-
bioRxiv - Pathology 2022Quote: ... 5 mg of 5-ethynyl-2′-deoxyuridine (EdU, A10044, Invitrogen) was dissolved in 1 ml of PBS as a stock solution ...
-
bioRxiv - Immunology 2024Quote: The glucose uptake in ILC2 was measured using the glucose analog 2-(N-(7-Nitrobenz-2-oxa- 1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG; ThermoFisher Scientific, Catalog No. N13195) which was stored at -20°C at a stock concentration of 10 mM (5 mg lyophilised powder in 1.46 mL dimethyl sulfoxide (DMSO)) ...
-
bioRxiv - Neuroscience 2024Quote: ... non-metabolizable glucose analogue 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino)-2-deoxyglucose (2-NBDG) (Thermo Fisher Scientific, cat.no. 11569116). Samples were prepared as described in the section ...
-
bioRxiv - Immunology 2021Quote: ... Copies of SARS-CoV-2 N were measured by qRT-PCR TaqMan Fast Virus 1-step assay (Applied Biosystems). SARS-CoV-2 specific primers and probes from the 2019-nCoV RUO Assay kit (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... the sections were incubated with SARS-CoV-2 antibody against the nucleocapsid (N) protein (ThermoFisher MA536086; 1:28,000 dilution) for 15min at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: RNA was isolated from WT and MafAS64F/+ islets (n=4 for males, n=5 for females) using the RNAqueous total RNA isolation kit (Ambion; Thermo Fisher), and then analyzed on an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Neuroscience 2021Quote: Drosophila heads (n=10) and thorax (n=5) were dissected and crushed in ice-cold LDS lysis buffer (NP0008, NuPAGE, Novex, Life Technologies) supplemented with reducing agent (NP0009 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 16 μL N,N,N’,N’-tetramethylethane-1,2-diamine (TEMED) (Fisher Scientific), 300 μL ammonium persulfate (APS ...
-
bioRxiv - Cell Biology 2022Quote: ... TEMED (N,N,N′,N′-tetramethylethylenediamine; cat. no. J63734.AC, Thermo Scientific) to polymerize the solution ...
-
bioRxiv - Neuroscience 2022Quote: 5-ethynyl-2’-deoxyuridine (EdU; Invitrogen) (10 μM ...
-
bioRxiv - Neuroscience 2023Quote: 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen) was dissolved at 0.2 mg/ml in the drinking water to detect proliferating cells ...
-
bioRxiv - Neuroscience 2023Quote: ... 5-Ethynyl-2’-deoxyuridine (EdU, ThermoFisher) was injected into the vitreous chamber to label proliferating cells ...
-
bioRxiv - Immunology 2023Quote: ... 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen) was dissolved in sterile PBS (5 mg/mL) ...
-
bioRxiv - Immunology 2024Quote: ... GBP-2 and GBP-5 (Invitrogen), monoclonal anti-mouse α- interferon (PBL) ...
-
bioRxiv - Neuroscience 2023Quote: ... and maintained in N2B27 media (1:1 of DMEM F12 Glutamax [Thermo Fisher Scientific, 10565018] and Neurobasal media [Thermo Fisher Scientific, 12348017], 1X N-2 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... in 1X of 2-(N-morpholino)ethanesulfonic acid (MES) buffer (Invitrogen, USA) for 35 min at 180V ...
-
bioRxiv - Neuroscience 2021Quote: ... supplemented with N-2 Supplement and B-27™ Supplement (Gibco Inc.), as well as 5 µg/mL insulin (Tocris Bioscience Inc) ...
-
bioRxiv - Biochemistry 2020Quote: ... and DnaK was labeled with BODIPY-fluorescein-N-(2-aminoethyl)-maleimide (Invitrogen) using maleimide-thiol chemistry as described60 ...