Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for Ethyl 5 2 3 difluorophenyl 5 oxovalerate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Samples (5 μl) were injected on a C18 PepMap trap column (5 μm, 100 μm I.D. x 2 cm, Thermo Scientific) at 10 μl/min ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples (5 μl) were injected on a C18 PepMap trap column (5 μm, 100 μm I.D. x 2 cm, Thermo Scientific) at 20 μl/min ...
-
bioRxiv - Developmental Biology 2023Quote: ... and incubated for 2-24hrs at 37°C 5% CO2 +/- myristoylated aPKC pseudosubstrate inhibitor (5 μM; Invitrogen; Product number 77749) in IMDM+0.1% BSA ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples (5 μL) were injected on a C18 PepMap trap column (5 µm, 300 µm I.D. x 2 cm, Thermo Scientific) at 20 µL/min ...
-
bioRxiv - Biochemistry 2024Quote: ... were maintained by continuous culture at 2-5% hematocrit in human erythrocytes with malaria culture medium (RPMI 1640 supplemented with 5 g/L Albumax II (Gibco), 0.12 mM hypoxanthine (1.2 ml 0.1 M hypoxanthine in 1 M NaOH) ...
-
bioRxiv - Immunology 2020Quote: ... 25 μl/well of 60 mM water solution of 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC, Thermo Fisher Scientific) were added ...
-
bioRxiv - Neuroscience 2023Quote: ... The carboxylic groups on the carbon fiber surface were electro-activated by incubation in 0.4 M 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC; Life Technologies) and 0.1 M and N-hydroxysulfosuccinimide (NHSS ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... discoideum clones on SM/5 plates (2 g glucose (Fisher Scientific), 2 g Bacto Peptone (Oxoid) ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (Click-iT Plus EdU Kit, Invitrogen) and 5-bromo-2’-deoxyuridine (BrdU ...
-
bioRxiv - Cell Biology 2020Quote: ... Twenty min before fixation EdU (5-ethynyl-2’-deoxyuridine, Molecular probes) was added in all the experiments ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2×10^5 cells were lysed in RIPA buffer (Thermo Fisher) with protease and phosphatase inhibitors (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were incubated with EdU (5-ethynyl-2’-deoxyuridine, Life technologies) at final concentration of 10 µM for 4 hours and then harvest to perform Click-iT reaction using Click-iT EdU flow cytometry Alexa Fluor 488 assay kit (Life technologies ...
-
bioRxiv - Genomics 2022Quote: ... supplemented with 5 mM MgCl2 and 2% penicillin–streptavidin (Gibco, #15140122). Minced tissue was digested with enzyme solution at 37°C for 60-90 min with gentle shaking ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 µM 5-ethynyl-2′-deoxyuridine (EdU) (Invitrogen, Carlsbad, CA, USA); 10 µM 5-bromo-2’-deoxyuridine (BrdU ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were included in the secondary antibody solution to stain nuclei.
-
bioRxiv - Genomics 2022Quote: ... supplemented with 5 mM MgCl2 and 2% penicillin–streptavidin (Gibco, #15140122). Tissue was incubated with enzyme solution for 30 min at 37°C with gentle shaking ...
-
bioRxiv - Neuroscience 2021Quote: ... pH 7.4) supplemented with 5 μM Fura-2 AM (Thermo Fisher), 50 μM pluronic acid F-127 (Thermo Fisher ...
-
bioRxiv - Plant Biology 2024Quote: For combined 5-ethynyl-2-deoxyuridine (Invitrogen A10044, Thermo Fisher Scientific) and modified pseudo-Schiff-propidium iodide (PI ...
-
bioRxiv - Plant Biology 2024Quote: For combined 5-ethynyl-2-deoxyuridine (Invitrogen A10044, Thermo Fisher Scientific) and modified pseudo-Schiff-propidium iodide (PI ...
-
bioRxiv - Plant Biology 2024Quote: ... respectively were stained with EdU (5-ethynyl-2′-deoxyuridine; Thermo Fisher) and modified pseudo-Schiff propidium iodide (PI ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNAs targeting DHHC 2 and 5 were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Neuroscience 2023Quote: ... 2% B-27 supplement and 5% fetal bovine serum (Invitrogen, Canada) plus 1/3 of minimum essential medium enriched with 1% penicillin/streptomycin ...
-
bioRxiv - Neuroscience 2023Quote: ... or 4°,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were added during the first wash step to visualize nuclei ...
-
bioRxiv - Immunology 2023Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (1 mg, Thermofisher, cat no: A10044) was injected intraperitoneally and mice were sacrificed after 2.5 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... 40 µM 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen, Waltham, MA, USA) was added to the cells ...
-
bioRxiv - Systems Biology 2024Quote: ... 2) Blocking buffer: wash buffer with 5% BSA (Thermo Fisher, J6509722). Hs27-VPH were transduced with lentiviruses of pRCA360 expressing sgRNA against HES7 ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of 5× SYPRO orange (Life Technologies, Eugene, Oregon, USA) and 2.5 µl of the resuspended array compound or the equivalent amount of buffer in the ligand-free control ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated in 5-ethynyl-2’-deoxyuridine (EdU; ThermoFisher A10044) dissolved in K-SFM (20 mM final concentration ...
-
bioRxiv - Physiology 2024Quote: After loading with Fura-2 AM (5 μM, Invitrogen, F-1201), isolated sweat glands on coverslips were mounted in an open chamber and rinsed with standard bath solution containing (in mM) ...
-
bioRxiv - Cancer Biology 2024Quote: ... incubated with 5-ethynyl-2′-deoxyuridine (EdU) (Thermo Fisher Scientific, C10636), then stained with a fluorescent CD34 antibody ...
-
bioRxiv - Cell Biology 2024Quote: ... transferred to 5 mL of LB broth (Fisher Scientific, BP1426-2), and incubated shaking overnight at 37℃ ...
-
bioRxiv - Biochemistry 2022Quote: ... TCEP HCl (Tris (2-carboxy ethyl phosphine) hydrochloride) was purchased from Thermo Scientific. All salts for buffers and reagents were of research grade and high purity ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 propanol and ethyl acetate were obtained from Fisher Scientific (Pittsburgh, PA, USA). Blood plasm was collected with the VACUETTE® K2 DTA Blood Collection Tube.
-
bioRxiv - Biochemistry 2022Quote: ... 2 propanol and ethyl acetate were obtained from Fisher Scientific (Pittsburgh, PA, USA). Oral fluid Quantisal® extraction buffer and collection devices were obtained from Immunalysis Corporation (Pomona ...
-
bioRxiv - Immunology 2021Quote: ... on the QuantStudio 5 or QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific). Relative transcript levels were normalized to TATA-binding protein (Tbp ...
-
bioRxiv - Molecular Biology 2021Quote: ... and CAF-1 p60 (5′-AAUCUUGCUCGUCAUACCA-3′) were transfected using RNAi MAX (Invitrogen).
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Genomics 2020Quote: ... or a positive control probe 5’-5Alexa488N/(ATA)8TUU (ATA)7-3’ (Invitrogen). Reactions were incubated in a water bath at 37°C for 2 hrs ...
-
bioRxiv - Cancer Biology 2020Quote: Non-targeting control (CTRL) (Dharmacon) 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3′-end fluorescent labeling of the RNAs with fluorescein-5-thiosemicarbazide (ThermoFisher Scientific) was done as previously reported (Grozdanov and Stocco ...
-
bioRxiv - Microbiology 2020Quote: ... 3 to 5 colonies were transferred in Mueller-Hinton broth (Thermo Scientific Oxoid) and adjusted to an optical density at 600nm (OD ...
-
bioRxiv - Immunology 2020Quote: Pieces of 3 mm3 tumors were submerged in 5 vol of RNAlater (Invitrogen) (n = 5 samples/group) ...
-
bioRxiv - Developmental Biology 2020Quote: 3 × 106 ESC cells were distributed to 5 12-well dishes (Thermo Scientific) with 5 × 105 mESC cells per well ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl RNA (2ng/μg) and 3 μl of 5x Primer stock (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Amplifications were run on a QuantStudio 3 or 5 thermal cycler (Thermo Fisher) and results were analyzed using the instrument software ...
-
bioRxiv - Cell Biology 2023Quote: ... vector encoding a sgRNA targeting PAC (5′-TGTCGAGCCCGACGCGCGTG-3′) using Lipofectamine 2000 (Invitrogen). GFP positive cells were isolated by FACS two days after infection ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using Accutase or ReleSR (ThermoFisher Scientific).
-
bioRxiv - Molecular Biology 2023Quote: ... 3 × 10-4 M MTG and 5% Protein-Free Hybridoma Media II (Gibco).
-
bioRxiv - Cancer Biology 2023Quote: 5’ and 3’ RACE was performed using the GeneRacer kit (Thermo Fisher Scientific), following the manufacturer’s protocol ...