Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for Ethyl 5 2 3 difluorophenyl 5 oxovalerate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... EdU (5-ethynyl-2’-deoxyuridne) (Thermo Fisher Scientific, #A10044) for 4 hours after incubating cells with serum-deprived media (RPMI +10% FBS ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... or SM/5 plates (2 g glucose (Fisher Scientific), 2 g BactoPeptone (Oxoid) ...
-
bioRxiv - Genetics 2020Quote: ... using the primer pair IL613 (5’-ACAAACACAATCCCAAGTTC-3’) and IL792 (5’-CCTTTACTACGTTGGCG-3’) (21) and the 2X Phusion™ Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific™, Waltham MA, USA) containing Phusion Flash II DNA polymerase which has proof-reading activity (36) ...
-
bioRxiv - Microbiology 2024Quote: ... Astrocytes were incubated with both 25 μM EIPA (5-(N-Ethyl-Nisopropyl) amiloride) (Bio-techne, 3378/10) and 10 μM Cytochalasin D (Gibco, PHZ1063) to observe the EV uptake mechanism ...
-
bioRxiv - Cell Biology 2020Quote: ... CDC20 was depleted using siRNA oligo #14 5’-CGGAAGACCUGCCGUUACA-3’ (ThermoFisher). siRNA oligos for PP2A-B55 and PP2A-B56 have been described (Hayward et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... 3-5 × 105 cells were settled on Polysine Slides (Thermo Fisher), fixed with 4% ...
-
bioRxiv - Neuroscience 2020Quote: ... FIVNC-555p (5’-FAM-CATGGCCACATTAATAATGG CGCA -TAMRA-3’ (Applied Biosystems, CA). These reactions were performed with a Bio-Rad iCyclerTM iQ and analyzed using the manufacturer’s software ...
-
bioRxiv - Cell Biology 2022Quote: ... DLP1-sense strand: 5’-UCCGUGAUGAGUAUGCUUUdTdT-3’ 31 (Ambion, Austin, TX, USA).
-
bioRxiv - Cell Biology 2020Quote: ... siRNA against MyoVa was obtained from Invitrogen (s9207, 5’ GUAUAGUCCUAGUAGCUA 3’) as this was shown to work well by Wu et al (2018) ...
-
bioRxiv - Immunology 2020Quote: ... Reactions were run on a Quantstudio 3 or 5 instrument (ThermoFisher). Cycling conditions for Quantifast reagents were ...
-
bioRxiv - Genomics 2021Quote: ... Linker oligo sequences were: 5’ – TTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNNCAGGCTACTCCGCTTAAGGGAC-3’ (linker 1, Invitrogen, UK) and 5’-GTCCCTTAAGCGGAGTAGCCTG/3AmMO/-3’ (linker 2 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5’- TTGGATCAGCTCAGACATATT-3’ or a nonspecific “scrambled” control (Invitrogen, United States). 72 hours after transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... or CRMP2 siRNA (5′ GTAAACTCCTTCCTCGTGT-3′; obtained from Thermo Fisher Scientific) using the 4D-Nucleofector (P3 Primary Cell Solution ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 days after transfection by 5 µl of lipofectamine 2000 (Invitrogen) with 2 µg of the plasmid and regularly re-sorted to maintain expression of myr/palm-mCherry.
-
bioRxiv - Microbiology 2023Quote: ... HSV-1 Probe FAM-5’-CGGCCCAACATATCGTTGACATGGC-3’-MGBNFQ (Thermo Fisher Scientific). The efficiency of each round of PCR was determined using 10-fold dilutions of Topo TA plasmids (Invitrogen AB ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using TryplE (Gibco 12604054). Naïve and primed hPSCs were expanded and induced into different lineages in a 5% CO2 incubator at 5% O2 at 37C.
-
bioRxiv - Cell Biology 2024Quote: ... The siRNA oligonucleotide targeting RIF1 sequence (Invitrogen; Sense: 5’-GAAUGAGCCCCUAGGGAAATT-3’) 138 was used ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA was isolated from sorted 2-3×10^5 CD34+ cells using the mirVANA miRNA isolation kit (Thermo Fisher) and subsequently processed using the Small RNA Library Prep kit (Norgen Biotek) ...
-
bioRxiv - Biophysics 2021Quote: ... slides were rinsed in PBS for 3 x 5 mins and stained with 1 %g/mL 4,6-diamino-2-phenylindole (DAPI - Molecular Probes) for 3 mins in the dark at RT ...
-
bioRxiv - Microbiology 2021Quote: ... and cDNAs were synthesized using SARS-CoV-2 nucleocapsid (N) reverse primer N660R (5’-AGCAAGAGCAGCATCACCGCCATTGCCAGC-3’) and M-MLV reverse transcriptase (Invitrogen). Then ...
-
bioRxiv - Biochemistry 2022Quote: ... Peptides were separated using 50 cm Acclaim PepMap 100 analytical column (75 μm ID, 3 μm C18) in conjunction with a Pepmap trapping column (100μm × 2 cm, 5 μm C18) (Thermo Scientific) analysed with Orbitrap Fusion Tribrid mass spectrometer (Thermo-Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 x 5 min) on a rocking platform and stained with 4′,6-diamidino-2- phenylindole dihydrochloride (DAPI) (Life Technologies) staining (2 μM ...
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...
-
bioRxiv - Genomics 2023Quote: ... For the construction of the RNH2A KO clones, RNASEH2A (Chr19, exon 2) gRNA (5’-TAACAGATGGCGTAGACCAT-3’) was cloned into GeneArtTM CRISPR Nuclease Vector with OFP reporter (Invitrogen) following manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: Duplex of the MEF2C enhancer sequence containing a mutation site [5′-ATGTATTTTTCTGCAATAAGT-3′ (×2)] in human genomic DNA were synthesized (Invitrogen). Additionally ...
-
bioRxiv - Cell Biology 2024Quote: ... or BODIPY 558/568 C12 (C12) (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (ThermoFisher, #D3835) were complexed with fatty acid-free bovine serum albumin (BSA ...
-
bioRxiv - Neuroscience 2022Quote: ... DiI (1,1’-Dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate, dissolved in 70% ethyl-alcohol; Invitrogen), for fluorescent marking aimed to track their position post-mortem ...
-
bioRxiv - Neuroscience 2020Quote: ... a selected cell terminal was puffed for 5 s with a solution containing 3-5 μM FM1-43 (Molecular Probes) and (in mM) ...
-
bioRxiv - Microbiology 2020Quote: The Q577R gp41 change was introduced into pSHIV-AD8-EO via site-directed mutagenesis using 5’p-TCAAGCAGCTCCGGGCAAGAGTCC-3’ (forward) and 5’p-TGCCCCAGACTGTGAGTTGCAACA (reverse) with Platinum SuperFi PCR mastermix (ThermoFisher) as described in the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were then washed 3 x 5 min in PBS and incubated for 5 min in DAPI (Invitrogen, cat# D1306) 1:1000 in PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... minced skin was incubated at 37°C for 3 – 5 hours in 5 ml of DMEM high glucose (#41965-039; Gibco) supplemented with 10 mg ml-1 collagenase (#C9891 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1.5 µg of total RNA of each sex were subjected to 5’ and 3’ RACE with a GeneRacer kit (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Bioengineering 2021Quote: ... Celsus Laboratories) was reacted with peptide-hydrazides using 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC, ThermoFisher Scientific) in 0.1 M MES [2-(N-morpholino)ethanesulfonic acid] buffer with 8 M urea (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... and 50 µL of 50 mg/mL 1-ethyl-3-[3-dimethyl-aminopropyl]-carbodiimidehydrochloride (Thermo Fisher Scientific, 22981) were simultaneously added to the reaction tubes ...
-
bioRxiv - Biochemistry 2020Quote: ... 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and N-hydroxysulfosuccinimide (Sulfo-NHS) were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Cell Biology 2024Quote: ... 4.0 × 107 beads were activated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Thermo Fisher Scientific [TFS] 22980) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Immunology 2023Quote: ... 4.0 × 107 beads were activated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Thermo Fisher Scientific [TFS] 22980) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Bioengineering 2024Quote: ... EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride) and Sulfo-NHS (N-hydroxysulfosuccinimide) were purchased from ThermoFisher (USA). Unless otherwise stated all other chemicals were received from Sigma (St Louis ...
-
bioRxiv - Cell Biology 2022Quote: ... 200µL 5-Ethynyl-2’-deoxyuridine (EdU, Molecular probes; 3g/L) was injected intraperitoneally in pregnant females 2 hours before embryo isolation.
-
bioRxiv - Developmental Biology 2020Quote: ... and 5.5 x 10-5 mol/L 2-mercaptoethanol (Gibco). For the endothelial potential assay ...
-
bioRxiv - Cancer Biology 2020Quote: 4-Amino-5-Methylamino-2’,7’-Difluorofluorescein Diacetate (DAF) (ThermoFisher) was used to measure and spatially resolve nitric oxide (NO ...
-
bioRxiv - Cell Biology 2020Quote: ... For 5-ethynyl-2’-deoxyuridine (EdU) incorporation assays (Life Technologies), 10μM EdU was included in culture for two hours ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5-ethynyl-2′-deoxyuridine (EdU) (Thermo Fisher Scientific, cat. #E10415) was diluted 2.5 mg/ mL in sterile PBS and injected intraperitoneally on days 3 and 4 post-injury at a dose of 10 μL/ g body weight ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU; Thermo Fisher Scientific, Waltham, MA) was either injected i.p ...
-
bioRxiv - Cancer Biology 2022Quote: ... or 2 - 5 μg/ml Puromycin Dihydrochloride (Thermo Fisher, # A1113803) until all negative control cells were dead ...
-
bioRxiv - Microbiology 2022Quote: ... or 0.1 mM 5-ethynyl-2’-deoxyuridine (EdU; Life Technologies) was added for the time indicated in the text.
-
bioRxiv - Cancer Biology 2022Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (Thermo Fisher Scientific, Barcelona, Spain) was added for 48h ...
-
bioRxiv - Immunology 2021Quote: ... 5 μM of 2′,7′-Dichlorofluorescin diacetate (DCFH-DA, Invitrogen) probe was added to each neutrophil subtype and incubated in the dark for 15 min ...
-
bioRxiv - Biophysics 2020Quote: ... while GRN-5 was expressed in Origami 2 DE3 (Invitrogen) as fusion constructs with a thioredoxin-A and hexa-histidine tag (TrxA-Hisx6-GRN) ...