Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for 6 Fluoro 4 hydroxy 1 7 naphthyridine 3 carbonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Bioengineering 2022Quote: Cell apoptosis was evaluated with CellEvent® Caspase 3/7 Green (Thermo Fisher, UK), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... CellEvent Caspase-3/7 green flow cytometry assay kit was purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were treated with CellEvent caspase-3/7 green detection reagent (ThermoFisher cat # C10423) according to manufacturer’s instructions at a final concentration of 8 µM ...
-
bioRxiv - Neuroscience 2021Quote: ... media was changed to Retinal Differentiation Media (RDM) [7:3 DMEM (Gibco 11965-118):F12 (Gibco #11765-054) ...
-
bioRxiv - Cell Biology 2023Quote: ... flow cytometric apoptosis quantification was performed using the CellEvent Caspase 3/7 kit (ThermoFisher) following the manufacturer’s recommendations.
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 6µM CellEvent Caspase-3/7 Green Detection Reagent (Thermofisher, #C10423, green fluorescence). Cancer cell lines (IGR-Heu and IGR-Pub ...
-
bioRxiv - Cell Biology 2023Quote: ... or CellEvent™ Caspase-3/7 Green Flow Cytometry Assay Kit (Thermo Fisher Scientific) to label apoptotic cells (Caspase-3/7 activity-positive and SytoxAADvanced-negative ...
-
bioRxiv - Cell Biology 2023Quote: ... Apoptotic cells were detected with CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen) (1:500) ...
-
bioRxiv - Cell Biology 2023Quote: ... the medium was switched to SFRM (DMEM/F12 [7:3] supplemented with B27 (Invitrogen), 2 mM L-glutamine).
-
bioRxiv - Neuroscience 2022Quote: ... and Alexa Fluoro-488 goat anti-rabbit IgG (H+L) (Invitrogen, A11034) in wash solution for 2 hours at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... donkey Alexa Fluoro 647-conjugated anti-goat IgG (#A11001; Thermo Fisher Scientific), and goat Alexa Fluoro488-conjugated anti-rabbit IgG (#A11001 ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes).
-
bioRxiv - Developmental Biology 2021Quote: ... samples were washed in block six times for 1 hour and incubated in secondary antibodies conjugated to fluorescent dyes diluted 1:250 in block with added 4’,6-diamidino-2-phenylindole (DAPI; 1:500 dilution of 1 mg/ml stock, Thermo Fisher) for 2 nights at 4°C.
-
bioRxiv - Cell Biology 2022Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes). Cells were imaged using a DeltaVision Ultra microscope with a 60X objective (NA = 1.42) ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were stained according to the same protocol as adult spinal cords using anti-2H3 (1:300, DHSB AB2314897) and Alexa fluoro-568 anti-mouse (1:250, Thermo Scientific, A-21124). Images were taken using a 20x lens on a Zeiss Axio Scan Z1 slide scanner ...
-
bioRxiv - Immunology 2021Quote: ... was added to a concentration of 1X and 12.5-30 μg of total protein from each sample was resolved on NuPAGETM 4-12% BisTris (Phospho-PMK-1 and Total-PMK-1) or NuPAGETM 3-8% TrisAcetate (TIR-1::3xFLAG) gels (ThermoFisher Scientific), transferred to nitrocellulose membranes using a Trans-Blot Turbo Transfer System (Bio-Rad Laboratories ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Microbiology 2021Quote: ... Cell monolayers were then stained with 3 mL of overlay containing a 1:1 mixture of 1.2% oxoid agar with 4% neutral red (Gibco) and 2X DMEM with 2% (vol/vol ...
-
bioRxiv - Neuroscience 2019Quote: ... Nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, 1:5000 in PBS) (Molecular Probes, Eugene, OR). The TUNEL stain signal was observed under an FV300 confocal microscope (Olympus Optical Company ...
-
bioRxiv - Microbiology 2021Quote: ... L454W/E455G and S262R) and mCherry (6:4:1 mixtures; 2.2 μg/well) using Lipofectamine® 2000 (Invitrogen), according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then stained with 1 μg/mL 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes/Thermo Fisher) and analysed on a FACSVERSE (BD Biosciences) ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then stained with 1 μg/mL 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes/Thermo Fisher) and analysed on a FACSVERSE (BD Biosciences) ...
-
bioRxiv - Physiology 2020Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole Dihydrochloride; 1:2000 diluted in PBTD; Thermo Fisher Scientific, Stockholm, Sweden; 62248) was added for 3 minutes followed by washing in PBTD for 25 minutes and mounting with ProLong gold antifade reagent (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... slices were counterstained with 4’,6-diamidine-2’-phenylindole 502 dihydrochloride (DAPI, D3571, Molecular Probes; dilution 1:1000) for 5 minutes followed by 2 minutes wash in PBS ...
-
bioRxiv - Bioengineering 2022Quote: ... the cell nuclei were stained with 1 μg/mL 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific #62248) in DPBS for 15 min at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: ... and pGL4.74-Renilla luciferase plasmids in a ratio of 0.5:1:0.1 (4 μg/6-well dishes) using Lipofectamine LTX PLUS (Invitrogen). The luciferase activity was assayed using the Dual-Luciferase Reporter Assay Kit (Promega) ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were either washed using DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride; 1:10000; Thermo Fisher Scientific, MA) made up in di H2O to stain for nuclei before being mounted or cover-slipped with ProLong Gold mounting medium with DAPI (Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Nuclei were stained by incubation with 0.5 – 1 µg/mL 4’,6-diamidino-2-phenylindole (DAPI, D1306, Invitrogen) in PBS for 10 min at RT ...
-
bioRxiv - Physiology 2023Quote: ... slides were stained with 1:10,000 DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific; Cat. No.: D3571) for 10 min at room temperature before coverslips were applied with PBS and glycerol (1:1 ...
-
bioRxiv - Cell Biology 2024Quote: ... we used 1-(4-Trimethylammoniumphenyl)-6-Phenyl-1,3,5-Hexatriene p-Toluenesulfonate (TMA-DPH; Thermofisher Scientific Cat. No. T204). Yeast cells were stained with 0.5µM TMA-DPH ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclear staining was performed using 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng ml−1; Molecular Probes). Sections were cover-slipped using ProLong Glass mounting agent (ThermoFisher) ...
-
bioRxiv - Cell Biology 2021Quote: ... embryos at the 3-6 somite stage were embedded oriented laterally in 1% low-melt agarose (Invitrogen, Carlsbad, CA) and imaged under bright field (to determine yolk elongation by taking major and minor axis measurements ...
-
bioRxiv - Neuroscience 2019Quote: ... harbouring the full-length cDNA coding for the human muscle 6-phosphofructo-1-kinase muscle isoform (PFK1-M)3 (accession number, NM_000289.1) using Lipofectamine LTX-PLUS Reagent (Life Technologies) according with manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... psPAX2 and pMD2.G with a ratio of 4:3:1 in Opti-MEM (Gibco, 31985070) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... with 1 ml per 4 million cells of 3 mM disuccinimidyl glutarate (DSG) (ThermoFisher Scientific, 20593) for 40 min at room temperature and quenched by 0.4 M Glycine for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... 3% sucrose) diluted 1:4 in Leibovitz’s L-15 medium without phenol red (Gibco, Waltham, MA) and an adjusted osmolality of 340 mOsm using 1 M sucrose ...
-
bioRxiv - Cell Biology 2024Quote: ... Sept-7 1/800 (Thermo scientific, PA5-54755), GAPDH 1/5000 (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... and optiMEM (1:6; Gibco) or were left untreated ...
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
REGN-COV2 antibody cocktail prevents and treats SARS-CoV-2 infection in rhesus macaques and hamstersbioRxiv - Microbiology 2020Quote: ... Reactions were carried out on a QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to the manufacturer’s specifications ...
-
bioRxiv - Immunology 2020Quote: ... Reactions were carried out on a QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to the manufacturer’s specifications ...
-
bioRxiv - Immunology 2020Quote: ... and ran in duplicate using the QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to manufacturer’s specifications ...
-
bioRxiv - Immunology 2021Quote: ... Reactions were carried out on a QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to the manufacturer’s specifications ...
-
bioRxiv - Immunology 2021Quote: ... Reactions were carried out on a QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to the manufacturer’s specifications ...
-
bioRxiv - Synthetic Biology 2023Quote: Protein thermal stability was measured by differential scanning fluorimetry using a QuantStudio Pro 6/7 (Applied Biosystems). Protein was brought to a concentration of 10 uM with 5x Sypro Orange dye in a final volume of 20 µL in 20 mM NaPi ...
-
bioRxiv - Cell Biology 2024Quote: Vacuolar pH alterations were detected using the 5-(and-6)-carboxy-2′,7′-dichlorofluorescein diacetate (CDCFDA, Invitrogen) probe ...
-
bioRxiv - Microbiology 2020Quote: ... we used 15 μL of a mixture of 4’,6-diamidin-2-phenylindole (4 μg mL−1) in SlowFade Gold Antifade Mounting medium (both Thermo Fisher Scientific, Waltham, MA, USA). All solutions and buffers for virus-targeted genomeFISH experiments were prepared with molecular grade water (Carl Roth ...
-
bioRxiv - Cell Biology 2021Quote: ... and/or CellTracker™ Blue CMAC (100 μM, 7-amino-4-chloromethylcoumarin, ThermoFisher Scientific). Stained cultures were re-normalized to equal cell numbers (0.5 OD600/mL) ...
-
bioRxiv - Genomics 2021Quote: ... After adding the RT mix (7 µl H2O, 4 µl 5x RT buffer [Invitrogen] ...