Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 6 Fluoro 4 hydroxy 1 7 naphthyridine 3 carbonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... The nuclear dye 4’,6-diamidino-2-phenylindole (DAPI) at 1 l ng/ml (Molecular Probes) was added to visualise all cells ...
-
bioRxiv - Physiology 2020Quote: ... Cell nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI; 1:10,000; ThermoFisher, Table S13). Confocal images were acquired using an inverted laser scanning confocal microscope (Nikon Eclipse C1) ...
-
bioRxiv - Neuroscience 2019Quote: ... Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole, 1:500, Molecular Probes, Eugene, USA) and images were obtained using a scanning confocal inverted microscope (TCS ...
-
bioRxiv - Immunology 2021Quote: ... Nuclei were counterstained with 1/2500 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, ThermoFisher Scientific, USA). The cover slips were fixed in fluorescence mounting medium (Fluoromount-G ...
-
bioRxiv - Immunology 2021Quote: ... Nuclei were counterstained with 1/2500 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, ThermoFisher Scientific, USA). The cover slips were fixed in fluorescence mounting medium (Fluoromount-G ...
-
bioRxiv - Cell Biology 2019Quote: ... DNA is stained with 1 mg/ul 4’,6-diamidino-2-phenylindole (DAPI) (ThermoFisher, Carlsbad, CA) 1/10,000 in PBS for 5 minutes and Vectashield mounting medium is applied (Vector Labs ...
-
bioRxiv - Cell Biology 2019Quote: ... DNA is stained with 1 mg/ul 4’,6-diamidino-2-phenylindole (DAPI) (ThermoFisher, Carlsbad, CA) 1/10,000 in PBS for 5 minutes and Vectashield mounting medium is applied (Vector Labs ...
-
bioRxiv - Bioengineering 2019Quote: ... Sections were also counterstained with 4′,6-diamidino-2-phenylindole (DAPI; 1:1000; Invitrogen, cat. #D1306). Immunocytochemical images were acquired with a confocal microscope (Olympus FV1000 Laser Scanning Confocal ...
-
bioRxiv - Cell Biology 2019Quote: ... also confirmed by 4′,6-diamidino-2-phenylindole fluorescent dye (DAPI, 1:1000, Molecular Probes, USA) staining.
-
bioRxiv - Immunology 2021Quote: ... Chamberslides were then incubated in 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI) (1:5,000, ThermoFisher Scientific) in 1x PBS for 5 min ...
-
bioRxiv - Immunology 2020Quote: ... cell nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, Karlsruhe, Germany, 1:100) for 30 min at RT ...
-
bioRxiv - Genomics 2021Quote: ... enzymatic dissociation was performed for 4–6 minutes at 37°C in 1 mL TrypLE (Invitrogen), then cell pellets were washed with ice-cold PBS and lysed with 1 mL of TRIzol (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 4′6-diamidino-2-phenylindole (DAPI, nuclei staining, 1:10000; Cat. no. D1306, Life Technologies) diluted in PBS for 30 min at RT ...
-
bioRxiv - Cancer Biology 2022Quote: ... Slides then were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) or with YOYO-1 (ThermoFisher). When HPV probe signal co-localized with YOYO-1 signal detecting DNA at 63x magnification ...
-
bioRxiv - Bioengineering 2022Quote: ... counterstained with 1 μg/mL of 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific, #D1306) for 30 minutes ...
-
bioRxiv - Immunology 2023Quote: ... Slides were washed and stained with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, D3571, 1:4000) in PBS for 10 min at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... enzymatic dissociation was performed for 4–6 min at 37 °C in 1 ml TrypLE (Invitrogen), then cell pellets were washed with ice-cold PBS and lysed with 1 ml of TRIzol (Invitrogen) ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-fluoro-deoxy-uridine (FDU) and nerve growth factor (NGF) (Invitrogen). Half of the media volume was exchanged every 5 days until cells were collected for analysis.
-
bioRxiv - Cancer Biology 2019Quote: ... 5(6)-carboxy-2’,7’-dichlorodihydrofluorescein diacetate (carboxy-H2DCFDA; CA-DCF-DA; (C400, ThermoFisher Scientific)) at a stock concentration of 20 mM in DMSO was diluted in DMEM without phenol red to a concentration of 40 μM ...
-
bioRxiv - Genomics 2020Quote: ... or a positive control probe 5’-5Alexa488N/(ATA)8TUU (ATA)7-3’ (Invitrogen). Reactions were incubated in a water bath at 37°C for 2 hrs ...
-
bioRxiv - Immunology 2020Quote: ... cells were treated with 2 mM caspase-3/7 detection reagent (Fisher Scientific) for 30 min ...
-
bioRxiv - Immunology 2020Quote: ... Apoptosis was detected using the CellEvent Caspase-3/7 Green Detection Reagent (ThermoFisher). Frames were captured over a period of 24 hrs at 1 hour intervals from 4 separate 1.75 x 1.29 mm2 regions per well with a 10× objective using IncuCyte S3 live-cell analysis system (Sartorius) ...
-
bioRxiv - Immunology 2020Quote: ... Apoptosis was detected using the CellEvent Caspase-3/7 Green Detection Reagent (ThermoFisher). Frames were captured over a period of 24hrs at 1-hour intervals from 4 separate 1.75 x 1.29 mm2 regions per well with a 10× objective using IncuCyte S3 live-cell analysis system (Sartorius) ...
-
bioRxiv - Immunology 2021Quote: ... In vitro derived PCs were stained with CellEvent Caspase 3/7-Green (ThermoFisher), tetrametylrhodamine ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with CellEvent Caspase 3/7 Detection Reagent (ThermoFisher Scientific, cat. no. C10423) to a final concentration of 2 μM ...
-
bioRxiv - Immunology 2021Quote: ... and 8 μM of CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen) for 30 min at 37°C 5% CO2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cytotoxicity was assessed using the CellEvent Caspase-3/7 Green Detection Reagent (ThermoFisher) at 1.0 µM and gating on CD45-negative cells ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher Scientific). Images were captured automatically every two hours for 48 hours using the IncuCyte™ S3 Live-Cell Analysis Instrument (Essen BioScience) ...
-
bioRxiv - Cell Biology 2023Quote: ... and treated with 2 µM Caspase-3/7 Green detection reagent (C10423, Invitrogen) along with the specified compounds ...
-
bioRxiv - Cell Biology 2021Quote: ... inverted and incubated with fluoro-Ruby-Dextran (1:100 of 100 mg/ml stock; 10,000 MW; Invitrogen CA) in Graces medium for 10 min ...
-
bioRxiv - Neuroscience 2020Quote: ... Replicates of hiPSC-derived neurons were harvested at three different timepoints of differentiation (days 1, 3, and 7) with 200 µl Trizol (Invitrogen) per sample and stored at −80 °C until sequencing ...
-
bioRxiv - Biophysics 2023Quote: ... cells were incubated with a dye master mix containing CellEventTM Caspase 3/7 Green Detection Reagent (ThermoFisher Scientific, 1:1000) and Zombie NIR fixable viability stain (BioLegend ...
-
bioRxiv - Molecular Biology 2023Quote: ... stained with N-(3-triethylammonium propyl)-4-(4-(dibutyl amino) styryl) pyridinium dibromide (FM 1-43FX, Invitrogen, Cat.-No. F35355) at 5.6 µg ml-1 ...
-
bioRxiv - Microbiology 2024Quote: ... at physiological pH before being spun down and resuspended in PBS with the addition of FM 1-43 Dye (N-(3-Triethylammoniumpropyl)-4-(4-(Dibutylamino) Styryl) Pyridinium Dibromide (Cat. no. T3163, Invitrogen). Images were taken on a Zeiss X10 light microscope and cell area was measured using CellProfiler 4.2.1 (33,34).
-
bioRxiv - Molecular Biology 2019Quote: ... either 50 µl (Figure 2A-2C, 7 and 8) or 25 µl (Figure 2D, 2E, 3-7 and 9) magnetic beads (Dynabeads protein G, Life Technologies #10004D) was used ...
-
bioRxiv - Cancer Biology 2019Quote: ... T-cells were co-cultured with the mCherry-Nucleus-7 MCF7 cells in the presence of CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher, C10423) in 96 well plates ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated for overnight with primary antibody at 4 degrees and further incubated with secondary antibodies (1:500) for 1 hour followed by 4′,6-diamidino-2-phenylindole (DAPI) or phalloidin 488 (1:400, Thermo Fisher, A12379) staining ...
-
bioRxiv - Cell Biology 2022Quote: ... the samples were added with a DNA-binding dye 4′,6-diamidino-2-phenylindole (DAPI, 1 µg mL-1 in PBS, Invitrogen) and phalloidin conjugated Alexa Fluor dye (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... iPS cells were passaged once a week (∼80% confluence/well) at 1:4-1:6 ratios using 1mg/ml collagenase (Gibco) to detach colonies and onto fresh ir-MEF plates.
-
bioRxiv - Genomics 2022Quote: ... resuspended in 1 mL NSB with 1:20 dilution of 0.25 mg/ml 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen D1306) and FACS sorted ...
-
bioRxiv - Biophysics 2023Quote: ... the samples were added with a DNA-binding dye 4’,6-diamidino-2-phenylindole (DAPI, 1 μg mL-1 in PBS, Invitrogen) along with the secondary antibody solution ...
-
bioRxiv - Cell Biology 2023Quote: ... 1.2 M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 µg/mL DAPI (4’, 6-diamidino2-phenylindole; Molecular Probes). Cells were imaged with a DeltaVision Ultra microscope with a 60X objective (NA = 1.42) ...
-
bioRxiv - Systems Biology 2021Quote: ... and 1:1000 7-AAD (ThermoFisher Scientific). Mouse IgG2A-488 (R&D systems ...
-
bioRxiv - Immunology 2019Quote: ... IL-7 (5 ng ml−1; ThermoFisher), and IL-15 (5 ng ml−1 ...
-
bioRxiv - Neuroscience 2021Quote: ... HT-7 (1:200, #MN1000, Thermo Scientific), GPC-4 (1:200 ...