Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for 6 Chloro 3H imidazo 4 5 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... cells were incubated with 4’,6-diamidino-2-phenylindole (DAPI, 62247, ThermoFisher Scientific) for 2 minutes at 1:2000 dilution in 1X PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... 6% Tris-glycine or NuPAGE 4-12% Bis-Tris gels (Invitrogen; cat# NP0321BOX) and transferred to Immobilon-P PVDF membranes (Millipore Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... and 300 µM of 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) was used to stain cell nuclei ...
-
bioRxiv - Genetics 2023Quote: ... For each 6-well added 2 mL of 4% PFA (cat#28906 Thermofisher) in PBS (cat#10010-023 Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... 4 and 6 hpi RNA was extracted from cells using TRIzol (Invitrogen; 15596026). RNA was isolated and precipitated following the manufacturer’s institutions and 200ng was reverse transcribed into cDNA using the ABI cDNA synthesis kit (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific). The preparations were analyzed under a confocal microscope Zeiss 510 LSM META and Zeiss 780-NLO (Carl Zeiss Microscopy ...
-
bioRxiv - Molecular Biology 2023Quote: ... Nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole) (Thermo Fisher Scientific). Finally ...
-
bioRxiv - Microbiology 2023Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) (ThermoFisher Scientific, 62248). The percentage of infected cells at each time point was quantified using ImageJ software.
-
bioRxiv - Microbiology 2023Quote: ... fixed cells were stained with 4’,6-diamidino-2-phenylindole (DAPI, Thermo Scientific) diluted 1:1000 in phosphate-buffered Saline (PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... nuclei were stained with DAPI (4’,6-diamino- 2-phenylindole, dihydrochloride, Thermofisher, #D3571) solution (0.5 mg/ml) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cell nuclei were labeled with dapi (4 ’, 6-diamidino-2-phenylindole, Invitrogen, P36931). Images were obtained in the Zeiss LSM 800 Confocal Optical Microscope at Centro de Micro y Nanoscopía de Córdoba (CEMINCO-CONICET-UNC ...
-
bioRxiv - Cell Biology 2024Quote: ... and stained with 4’,6-diamdino-2-phenylindole (DAPI) (1:500, ThermoFisher, 62248) in 1X DPBS for 20 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2024Quote: ... All sections were counterstained with 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher) before mounting.
-
bioRxiv - Molecular Biology 2024Quote: ... sections were counterstained using 4’,6-diamidino-2-phenylindole (DAPI, 1:300, Invitrogen) and mounted with glycerol-gelatin aqueous slide mounting medium (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300 μM of 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) was used to stain cell nuclei.
-
bioRxiv - Microbiology 2020Quote: ... 4 μl of 5 mg/ml linear acrylamide (Ambion), 600 μl of preheated (65°C ...
-
bioRxiv - Microbiology 2021Quote: ... siDDX42-4: 5’-AUCUCGAAUACCCUUUACG-3’ (ID:136410, Ambion®).
-
bioRxiv - Cell Biology 2022Quote: ... and Ca2+-indicator Fluo-4/AM (5 μM, Invitrogen) in the presence of Pluronic F-127 (0.02% ...
-
bioRxiv - Biochemistry 2021Quote: ... Hi-5 cells (BTI-TN-5B1-4) (Gibco #B85502) were cultured in Express Five™ SFM (Serum-Free Media ...
-
bioRxiv - Physiology 2022Quote: ... Dionex Ionpac AG11-HC b (2 mm x 50 mm, 4 μm particle size, ThermoFisher Scientific), was placed before the separation column ...
-
bioRxiv - Neuroscience 2023Quote: ... at 1% B with Solvent A as 0.1% formic acid in water (Thermofisher Optima LS118-4) and Solvent B as 0.1% formic acid in acetonitrile (Thermofisher Optima LS120-4) ...
-
bioRxiv - Plant Biology 2024Quote: ... and a 0.1% formic acid in acetonitrile (B) (A998-4, Thermo Fisher Scientific, Waltham, MA, USA). The column temperature was 25 °C ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Immunology 2024Quote: ... Dried polar metabolites were dissolved in 15 μL of 2% methoxyamine hydrochloride in pyridine (Thermo Fisher Scientific, 25104) at 55°C ...
-
bioRxiv - Plant Biology 2019Quote: ... pollinated stigma was incubated in FM™ 4-64 Dye (N-3-Triethylammoniumpropyl-4-6-4-Diethylamino Phenyl Hexatrienyl Pyridinium Dibromide, Life Technologies T3166, 8.23 μM) for five minutes and subsequently washed in 1/2 Murashige and Skoog basal medium containing 10 % (w/v ...
-
bioRxiv - Microbiology 2021Quote: ... Streptomyces hyphae were incubated with 0.5 mg/ml FM 4-64 Dye (N-(3-Triethylammoniumpropyl)24-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Molecular Probes) for 15 min in the dark ...
-
bioRxiv - Biophysics 2022Quote: ... blotted for 4-6 s at 4°C and 100% humidity using a FEI Vitrobot Mark IV (Thermo Fisher Scientific), and plunge frozen in liquid ethane ...
-
bioRxiv - Biophysics 2022Quote: ... blotted for 4-6 s at 4°C and 100% humidity using a FEI Vitrobot Mark IV (Thermo Fisher Scientific), and plunge frozen in liquid ethane ...
-
bioRxiv - Bioengineering 2024Quote: ... DAPI (4′-6-diamidino-2-phenylindol) and Myosin Heavy Chain (Myosin 4, eFluor™ 660, Clone: MF20, Affymetrix eBioscience™). All images were taken using a confocal microscope (Zeiss LSM 780 Airyscan ...
-
bioRxiv - Neuroscience 2023Quote: ... At 5-6 dpf each FoxP2.A:FingR(PSD95)+ larva was placed into individual wells of a 6-well plate (Thermo Fisher Scientific) containing approximately 10mL of fish water ...
-
bioRxiv - Immunology 2020Quote: ... Serial frozen sections (6 μm in thickness) were cut on a cryostat and counterstained with DAPI (4′,6-Diamidine-2′-phenylindole; Thermo Fisher Scientific). The number of beads in the SED from 3-4 sections of two Peyer’s Patches per mouse (n=3–4 mice/group ...
-
bioRxiv - Developmental Biology 2022Quote: ... with a 6-FAM™ fluorescent tag at its 5’ end (Life Technologies). Three primers PCR amplification were performed using the Qiagen Multiplex PCR kit (206143 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5-(and-6)-chloromethyl-2′,7′ dicholorodihydrofluorescein diacetate (CM-H2DCFDA; Molecular Probes C6827), was used to visualize ROS accumulation (excitation ...
-
bioRxiv - Immunology 2022Quote: ... or 2.5μM of 5-(and-6)-Carboxy-2’,7’-Dichlorofluorescein Diacetate (DCFDA) (Invitrogen) was then added and incubated with the cells 20 minutes at 37°C ...
-
bioRxiv - Immunology 2020Quote: ... Cells were grown for 5–6 days in IMDM (Thermo Fisher Scientific, 12440053) supplemented with 1% non-essential amino acids (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... or 5- (and -6)-chloromethyl- 2′,7′-dichlorofluorescein diacetate (CM-H2DCFDA, ThermoFisher, C6827), or hydroxyphenyl fluorescein (HPF ...
-
bioRxiv - Immunology 2024Quote: ... 5 µg of anti-CD8α APC-efluo780 (clone 53-6-7, eBioscience/Thermofisher) was injected intravenously (i.v. ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Peptides were eluted along an optimized 90 min gradient from 6 to 40% Mixture B (80% ACN/0.5% formic acid) with an EASY-nLC 1,200 system (Thermo Fisher Scientific). Spray voltage was set to 2.2 kV ...
-
bioRxiv - Neuroscience 2023Quote: ... (6) Negative photoresist SU-8 2000.5 was mixed with Lissamine rhodamine B ethylenediamine (RhBen; ∼10 μg/ml; Thermo Fisher Scientific) and placed in the dark at room temperature (RT ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μCi γ32P-ATP and 350 ng CDK1/Cyclin B Recombinant Human Protein (Thermo Fisher PV3292) in kinase buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Microbiology 2023Quote: ... The substrate used in figure 3H is SuperSignal Western Blot Substrate Pico (ThermoFisher), and for increased sensitivity in figure 3I ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific) and cells were mounted using Prolong Gold Antifade reagent (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... Before mounting cells were stained with DAPI (4’,6-diamidino-2-phenylindole) dye (ThermoFisher) and mounted with Dako mounting medium and imaged by confocal microscopy and previously described 19.
-
bioRxiv - Developmental Biology 2021Quote: ... and subsequently incubated in 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI) nuclear stain (Invitrogen). Slides were then washed in PBS and mounted using Prolong Gold Mounting Medium ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and the fluorescent dye 4’,6-diamidino-2-phenylindole (DAPI; 1:1,000, Molecular Probes), respectively.
-
bioRxiv - Developmental Biology 2020Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI: nuclear counterstain; 1:1000; ThermoFisher, Waltham, MA).
-
bioRxiv - Neuroscience 2021Quote: ... Brain slices were incubated with 4’,6-diaminodino-2-phenylindole (DAPI, Invitrogen, 1:1000) for 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole) (1:106, 62248, Invitrogen) for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were resolved on 4-12% or 6% NuPAGE Bis-Tris gels (ThermoFisher Scientific) and transferred onto nitrocellulose membranes (Bio-Rad ...