Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 6 Chloro 3H imidazo 4 5 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... 2-(4-amidinophenyl)-1H -indole-6-carboxamidine (DAPI; Thermo Fisher Scientific – D1306), 5X All-In-One RT MasterMix with AccuRT Genomic DNA Removal Kit (Applied Biological Material - G492) ...
-
bioRxiv - Immunology 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) or Live/ dead fixable blue (ThermoFisher) was used to discriminate live/dead cells ...
-
bioRxiv - Microbiology 2021Quote: ... and counterstaining with DAPI (4’, 6-diamidino-2-phenylindole, ThermoFisher, 1:10000) and phalloidin (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... DNA was visualized with 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies). Sections were imaged with a Zeiss Cell Observer inverted microscope using a 40x objective ...
-
bioRxiv - Cell Biology 2021Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI, Life Technologies) (1:1000) ...
-
bioRxiv - Immunology 2021Quote: ... Nuclei were stained using 4’,6-Diamidin-2-phenylindol (DAPI, Invitrogen, #D1306) and images were acquired at a distance of 900 μm from the border of the lesion in layer 4 (ipsilateral ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated with 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, D1306; Molecular Probes) in PBS and mounted with ProLong Gold Antifade Mountant (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen D1306; to label nuclei) using the following protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were counterstained with DAPI (4’,6-Diamidine-2’-phenylindole dihydrochloride - Invitrogen) for staining nuclei ...
-
bioRxiv - Microbiology 2023Quote: ... 4’,6’-diamino-2-fenil-indol (1:25000) (DAPI, Life Technologies, USA) and Phalloidin (1:500 ...
-
bioRxiv - Microbiology 2023Quote: ... The 4’,6’-diamino-2-fenil-indol (DAPI) (1:2500, Life Technologies) and the Phalloidin (Alexa-488 ...
-
bioRxiv - Immunology 2023Quote: ... and counterstained with DAPI (4’, 6-diamidino-2-phenylindole, Thermo Fisher Scientific). Sections were examined with a Nikon A1 confocal microscope and LY molecule tissue infiltration (depicted in green channel images included in Fig 4C ...
-
bioRxiv - Cancer Biology 2022Quote: ... and DAPI (4, 6-diamidino-2-phenylindole dihydrochloride; Invitrogen, D1306, 1:500).
-
bioRxiv - Cancer Biology 2023Quote: ... 4′,6-Diamidino-2-phenylindole (DAPI; D1306; Thermo Fisher Scientific, Waltham, MA) was used to stain cell nuclei ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were counterstained with DAPI (4’,6-diamidino-2-Phenylindole, Dihydrochloride - Invitrogen) for staining nuclei ...
-
bioRxiv - Developmental Biology 2023Quote: ... with 4′6-diamidino-2-phenylindole (DAPI, 00-4959-52, Thermo Fisher), was used to visualize nuclei and as mounting medium ...
-
bioRxiv - Cancer Biology 2023Quote: ... and stained with 4′,6-diamidino-2-phenylindole (DAPI) (ThermoFisher Scientific: D1306) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... incubated with 4′,6-diamidino-2-phenylindole (DAPI) as directed (Invitrogen, D1306), and washed with PBS ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were stained with 4′,6′-diamidino-2-phenylindole (DAPI) (Thermo Fisher) nuclear stain diluted in PBS for 5 min with rocking ...
-
bioRxiv - Developmental Biology 2023Quote: ... with DAPI (4’, 6-Diamidino-2-Phenylindole) (Life Technologies; D1306; 1:10,000). Images were captured using a Nikon Eclipse 80i system with the NIS-Elements BR software (version 4.3 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 6 weeks-of-age was fixed in 4% paraformaldehyde (Acros Organics), cryo-preserved using 30% sucrose (Fisher) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were then counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (ThermoFisher) solution in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Bioengineering 2024Quote: ... then incubated with 4’-6-diamidino-2-phenylindole (DAPI; Invitrogen, Waltham, MA) for 20 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... the fluorescent dsDNA-labelling dye 4′,6-diamidino-2-phenylindole (DAPI, ThermoFisher) was added to the culture at a concentration of 5 µg.mL−1 for 10 minutes prior imaging ...
-
bioRxiv - Biophysics 2023Quote: ... the nucleus with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, 1:200), microtubules with an anti-tubulin antibody produced in mouse (1:200 ...
-
bioRxiv - Bioengineering 2023Quote: ... Slowfade gold antifade mountant containing 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) was used to rinse and seal the coverslips ...
-
bioRxiv - Genetics 2023Quote: ... and stained with DAPI (4′,6-diamidino-2-phenylindole) (Thermo Fisher Scientific). Germlines were mounted in Vectashield (VectorLabs ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclei were stained with 4′,6-Diamidin-2-phenylindol (DAPI, Invitrogen, #D1306) 1:10,000 or DRAQ5 (ThermoFisher ...
-
bioRxiv - Bioengineering 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:5000; Invitrogen; Carlsbad, CA, USA) allowed visualization of cell nuclei ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.25 μg/ml of 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes) was added to immunolabeled cells for 10 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific, Waltham, MA, USA) was used to label all nuclei ...
-
bioRxiv - Cell Biology 2022Quote: ... Guide RNA primer sets A (KS40 5’-ACCGACCACAGAAACTGCGACTAG -3’ and KS41 5’-AACCTAGTCGCAGTTTCTGTGGTC-3’) and B (KS42 5’-CCGTCCCACTGGCACCGCTTTATG-3’ and KS43 5’-AAACATAAAGCGGTGCCAGTGGGA-3’) were phosphorylated with T4 polynucleotide kinase (ThermoFisher) at 37°C for 30 min and annealed by cooling down from 85°C to 25°C at 0.1°C/sec ...
-
bioRxiv - Bioengineering 2022Quote: CD19+ NALM-6 cells (B cell acute lymphoblastic leukemia) were stained with Cell Trace Violet (Thermo Fisher Scientific) and primary human CD8+ T cells were stained with either Cell Trace Yellow (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2024Quote: ... 6 rat samples (ExpA, B and C) were placed directly in Leibovitz’s L-15 medium (Gibco 11415-064) to develop organoids immediately ...
-
bioRxiv - Pathology 2020Quote: ... CHO cells were transfected with 5 ug of human cadherin-6 in pIRES-puro or mouse cadherin-6 in pCDNA3.1 via Lipofectamine 2000 (Invitrogen). After 48hrs ...
-
bioRxiv - Neuroscience 2022Quote: ... The final pellet was resuspended in 0.5 mL of NRB containing 6 μM 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher; D1306). The suspension was filtered through a 20 μm filter (Sysmex ...
-
bioRxiv - Microbiology 2022Quote: 293T-ACE2 and HT1080-ACE2 cells were seeded in 24-well plates and 6-well plates respectively to achieve 70% confluency after 4-6 hours and then transfected with Lipofectamine RNAiMAX (Thermofisher) using the indicated dsiRNAs (IDT ...
-
bioRxiv - Physiology 2020Quote: ... and incubated with 100 mM 6-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (6-NBDG) (Life Technologies) in 10 nM Tris/HEPES buffer containing 150 mM KCl or 150 mM NaCl for 30 minutes at 37 °C ...
-
bioRxiv - Plant Biology 2023Quote: ... and 0.1% formic acid in acetonitrile (B) (A998-4, Thermo Fisher Scientific, Waltham, MA, USA). The column temperature was set to 45 °C ...
-
Sapogenin based self-assembly structures activating a non-apoptotic cell death via multiple pathwaysbioRxiv - Pharmacology and Toxicology 2021Quote: 100 mg AG was dissolved in pyridine and 450 mg p-TsCl (p-Tosyl Chloride, Acros Organics) reagent was added ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT, #I00671G, Fisher Scientific).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Developmental Biology 2022Quote: ... and passaged very 3-4 days with a 1:4-6 passage ratio using Versene solution (Life Technologies 15040066).
-
bioRxiv - Cell Biology 2020Quote: ... Cells were passaged every 5 or 6 days using Versene (Gibco, A4239101). Clinical hESCs were tested weekly for mycoplasma contamination using a Myco-detection Kit (InvivoGen ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 Bcl6 and 6 Smyd2 KO livers using TRIzol reagent (Invitrogen #15596026) followed by purification using the RNeasy Mini kit (Qiagen #74014) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... С6 and CHO/5-HT2C were maintained in the F12 medium (Invitrogen). In all cases ...
-
bioRxiv - Bioengineering 2024Quote: ... Coupling 5-(and 6)-Carboxytetramethylrhodamine (TAMRA) mixed isomers (Thermo Scientific, Waltham, MA) and Fmoc-8-amino-3,6-dioxaoctanoic acid (Fmoc-PEG2-OH ...
-
bioRxiv - Biophysics 2021Quote: ... buffer B (5 mM Tris-HCl pH 8.0, 10 mM MgCl2, 1 mM EDTA; Ambion), BSA-biotin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... isolated B cells were stained with Cell Proliferation Dye eFluor™ 670 (5 μM, Invitrogen) and measured after 48 and 96 h.
-
bioRxiv - Biophysics 2020Quote: ... and 5 mL of B-PER™ complete bacterial protein extraction reagent (Thermo Scientific #89821) with 2 mM MgCl2 ...