Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for 6 4 methylpiperazin 1 yl pyridine 3 boronic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... sections were counterstained with 4’,6-diamidine-2’-phenylindole dihydrochloride (DAPI, D3571, Molecular Probes, dilution 1:1000), re-washed ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were counterstained with 4’,6-diamino-2-phenylindole dihydrochloride (DAPI, 1:10000 in PBS, Thermo Scientific) and mounted with a cover glass using Fluoromount (Diagnostic BioSystems ...
-
bioRxiv - Neuroscience 2022Quote: ... Nuclei were visualized with Hoechst (4′,6-diamidino-2-phenylindole) (DAPI) (Invitrogen; 3258, ICC/IHC 1:5,000).
-
bioRxiv - Physiology 2022Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (1:2500, DAPI, ThermoFisher Scientific, Cat No. D1306). Images were taken using Zeiss 880 confocal microscopy and quantified by using Fiji/ImageJ86.
-
bioRxiv - Neuroscience 2023Quote: ... cell nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific, 1:5000 dilution) for 15 mins ...
-
bioRxiv - Biochemistry 2023Quote: ... The slides were then incubated with 1 ug/ml of 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen) in 1xPBS for 20 min at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclear stain: 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI, blue; 2 ng ml−1; Molecular Probes, USA). Sections were cover-slipped using ProLong Gold anti-fade reagent (Invitrogen ...
-
bioRxiv - Developmental Biology 2024Quote: ... Antibodies were used together with DAPI (4’,6-diamidino-2-phenylindole, Thermo Scientific, 62248, 1:1,000 dilution). NDE1 (Abnova ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 1% penicillin/streptomycin with passaging every 3–4 days using in DPBS (Life technologies) supplemented with 0.5 mM EDTA (Life technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... Media was changed daily and the cells passaged every 3–4 days at a ratio of 1:4 using the StemPro EZPassage tool (ThermoFisher Scientific).
-
bioRxiv - Microbiology 2020Quote: ... The assay is based on the dilution of co-mixed N-(7-nitro-benz-2-oxa-1,3-diazol-4-yl)phosphatidylethanolamine (N-NBD-PE) and N-(lissamine Rhodamine B sulfonyl)phosphatidylethanolamine (N-Rh-PE) (Molecular Probes, Eugene, OR, USA), whereby dilution due to membrane mixing results in increased N-NBD-PE fluorescence ...
-
bioRxiv - Neuroscience 2020Quote: Neocortex from C57Bl/6 pups (postnatal day 1-3) was dissected in Hibernate-A medium (#A1247501, Gibco, USA), digested with papain (#LS003124 ...
-
bioRxiv - Cell Biology 2020Quote: ... 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, D1306) was utilized to detect the nuclei ...
-
bioRxiv - Microbiology 2021Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2020Quote: ... DAPI (4’,6-diamidino-2-phenylindole dihydrochloride, ThermoFisher Scientific, D1306) was applied to nuclei samples at a concentration of 0.1µg/ml ...
-
bioRxiv - Bioengineering 2020Quote: ... incubated with 4′,6-diamidino-2-phenylindole (DAPI, Thermo Fisher), rinsed with TBS ...
-
bioRxiv - Biophysics 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed for actin cytoskeleton and nucleus staining ...
-
bioRxiv - Cancer Biology 2020Quote: ... SSC and DAPI (4’,6-diamino-2-phenylindole) (Fisher Scientific) staining profiles ...
-
bioRxiv - Bioengineering 2019Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, NucBlue Fixed, Life Technologies) for cell count and nuclear aspect ratio ...
-
bioRxiv - Neuroscience 2019Quote: ... counterstained with 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI;ThermoFisher) and mounted with Vectashield H1400 Hardset Mounting Medium (Vector Labs) ...
-
bioRxiv - Cell Biology 2019Quote: ... DAPI (4’,6-diamino-2-phenylindole, Life Technologies, Ref#D3571) and Calcein AM staining profiles and Calcein AM (Life Technologies ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... containing 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, Cat # P36935), and analyzed by LSM510 Meta Laser or Leica TCS SPE confocal microscopes (× 63 glycerol immersion objectives ...
-
bioRxiv - Cancer Biology 2022Quote: ... DAPI (4′,6-Diamidino-2-Phenylindole; Thermo Fisher Scientific, D1306),
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, Invitrogen Cat. D1306), was added ...
-
bioRxiv - Microbiology 2023Quote: ... stained with 4’,6-diamidino-2-phenylindole (DAPI, Thermo Scientific) and LACV antibody as described below ...
-
bioRxiv - Microbiology 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific, Waltham, MA) was used to label nuclei ...
-
bioRxiv - Cancer Biology 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole) was from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, D1306) was utilized to detect the nuclei ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific - D1306) was used 1:10000 ...
-
bioRxiv - Microbiology 2023Quote: ... Counterstaining was with 4’-6-diamidino-2-phenylindole (DAPI) (Invitrogen) at 20 µg/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... DAPI (4’,6-Diamidin-2-phenylindol, Dihydrochloride; Thermo Fisher Scientific) staining was performed prior to recording ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher D1306) and stored in the dark at 4°C until imaging.
-
bioRxiv - Immunology 2020Quote: ... before staining with 3 μM fluo-4 (Invitrogen) and 4 μM Fura Red (Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Lot 134874), and 4-(2-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, purity ≥ 99.%, CAT #BP310-1, Lot 052975) were from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Genomics 2021Quote: ... and then blocked for 1 hour with 1 ml of blocking buffer (wash buffer containing 3% fatty acid free BSA (Thermo Fisher, 126609)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 7-Diethylamino-3-(4'-Maleimidylphenyl)-4-Methylcoumarin (CPM) was purchased from Thermo Scientific Life Technologies (Grand Island ...
-
bioRxiv - Microbiology 2021Quote: ... lysates were spun at 10,000 x g for 10 minutes at 4 °C prior to reaction with 4- acetamido-4’-maleimidyl-stilbene-2,2’-disulfonic acid (AMS) (ThermoFisher Scientific). AMS alkylation was performed by vortexing the lysates in 15 mM AMS ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% nonessential amino acids (Invitrogen), 0.1mM β-mercaptoethanol (Sigma) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% nonessential amino acids (Invitrogen), 1% Sodium-pyruvate (BI 03-042-1B) ...
-
bioRxiv - Biochemistry 2020Quote: ... span)/1‰ formic acid (Fisher Scientific), phase B ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% nonessential amino acids (Gibco) and supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2021Quote: ... 1% nonessential amino acids (Invitrogen), 100 μg/mL of streptomycin (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... 1% nonessential amino acids (Gibco), 2% tryptose phosphate broth (Sigma) ...
-
bioRxiv - Microbiology 2019Quote: ... 1% nonessential amino acids (Invitrogen) and 1% penicillin (Invitrogen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1% nonessential amino acids (Gibco), 2 mM L-glutamine and 1,000 U/mL leukaemia inhibitory factor (LIF ...
-
bioRxiv - Biophysics 2019Quote: ... 1% nonessential amino acids (Gibco), 2 mM sodium pyruvate (Gibco) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1× nonessential amino acids (Gibco), 1× sodium pyruvate (Gibco ...
-
bioRxiv - Biochemistry 2020Quote: ... Spain)/1‰ formic acid (Fisher Scientific), phase B ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1% nonessential amino acids (Gibco), 1% penicillin/streptomycin (Gibco) ...