Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for 6 4 methylpiperazin 1 yl pyridine 3 boronic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 1% nonessential amino acids (Gibco), 1% HEPES (Gibco) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1× nonessential amino acids (Gibco), 0.1 mM β-mercaptoethanol (Gibco) ...
-
bioRxiv - Microbiology 2022Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Gibco), 100 U/ml penicillin–100 μ/ml streptomycin ...
-
bioRxiv - Biochemistry 2023Quote: ... Spain)/1‰ formic acid (Fisher Scientific), phase B ...
-
bioRxiv - Molecular Biology 2023Quote: ... nonessential amino acids (1%; Invitrogen), trace elements (1% ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% nonessential amino acids (Gibco). Tamoxifen resistant (TamR ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% nonessential amino acids (Gibco), 1mM sodium pyruvate (Gibco) ...
-
bioRxiv - Immunology 2024Quote: ... 1% nonessential amino acids (Invitrogen), 1% sodium pyruvate (Invitrogen) ...
-
bioRxiv - Immunology 2024Quote: ... 1% nonessential amino acids (Invitrogen), 1% sodium pyruvate (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... PBS was replaced with a 1:6 (weight: volume) solution of 0.5 M acetic acid (984303; Thermo Fisher, Waltham, MA, USA) with 1 mg/ml pepsin (20343 ...
-
bioRxiv - Neuroscience 2021Quote: ... buffered with 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Life Technology, Thermo Fisher Scientific Inc., USA) and coated with 20 μg/mL laminin (Sigma Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 25 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) and 10% Hi-FBS (Thermo Fisher Scientific). BSC-1 cells (ATTC ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes).
-
bioRxiv - Developmental Biology 2021Quote: ... samples were washed in block six times for 1 hour and incubated in secondary antibodies conjugated to fluorescent dyes diluted 1:250 in block with added 4’,6-diamidino-2-phenylindole (DAPI; 1:500 dilution of 1 mg/ml stock, Thermo Fisher) for 2 nights at 4°C.
-
bioRxiv - Cell Biology 2022Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes). Cells were imaged using a DeltaVision Ultra microscope with a 60X objective (NA = 1.42) ...
-
bioRxiv - Physiology 2022Quote: ... The nucleic acids present in the pituitary gland cells were visualised with TOTO-3 (1:2000, Thermo Fisher Scientific). Sections were incubated with TOTO-3 for 15 min on an agitated surface ...
-
bioRxiv - Immunology 2021Quote: ... was added to a concentration of 1X and 12.5-30 μg of total protein from each sample was resolved on NuPAGETM 4-12% BisTris (Phospho-PMK-1 and Total-PMK-1) or NuPAGETM 3-8% TrisAcetate (TIR-1::3xFLAG) gels (ThermoFisher Scientific), transferred to nitrocellulose membranes using a Trans-Blot Turbo Transfer System (Bio-Rad Laboratories ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Neuroscience 2021Quote: ... neurons were anchored with succinimidyl ester of 6-((Acryloyl)amino) hexanoic acid (AcX) (Thermofisher) in PBS (0.1mg/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... SE (6-((acryloyl)amino)hexanoic acid)-labelled fibronectin (A20770, ThermoFisher Scientific; FC010, EMD Millipore), and polymerized on activated glass coverslips for 1 hr at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... Cell monolayers were then stained with 3 mL of overlay containing a 1:1 mixture of 1.2% oxoid agar with 4% neutral red (Gibco) and 2X DMEM with 2% (vol/vol ...
-
bioRxiv - Biochemistry 2020Quote: ... 4 μL of 10% of trifluoroacetic acid (Thermo Fisher Scientific, Inc.) was added to the digested mixture and incubated at 37 °C for 30min ...
-
bioRxiv - Neuroscience 2022Quote: ... Probenecid (4-(dipropylsulfamoyl)benzoic acid) (water soluble form, ThermoFisher Scientific, P36400) was used at 1mM (after calibrating the effect between 250 µM and 1 mM).
-
Sapogenin based self-assembly structures activating a non-apoptotic cell death via multiple pathwaysbioRxiv - Pharmacology and Toxicology 2021Quote: 50 mg CG was dissolved in pyridine and 150 mg N-Ac-Sulfa (Acros Organics) reagent was added ...
-
Sapogenin based self-assembly structures activating a non-apoptotic cell death via multiple pathwaysbioRxiv - Pharmacology and Toxicology 2021Quote: 40 mg AG was dissolved in pyridine and 80 mg N-Ac-Sulfa (Acros Organics) reagent was added ...
-
bioRxiv - Biochemistry 2023Quote: ... The sample was reconstituted in 50 µL of methoxyamine HCL in pyridine (Thermo Scientific, Pennsylvania) for 1.5 hours at 30 °C with stirring ...
-
bioRxiv - Physiology 2023Quote: ... USA) with exception of the pyridine and methoxyamine hydrochloride (Thermo Fisher Scientific, Waltham, MA, USA).
-
bioRxiv - Physiology 2020Quote: Acid extracted rat tail Type I Collagen (3 mg/mL; Thermo Fisher) was maintained at 4°C until polymerization ...
-
bioRxiv - Neuroscience 2019Quote: ... Nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, 1:5000 in PBS) (Molecular Probes, Eugene, OR). The TUNEL stain signal was observed under an FV300 confocal microscope (Olympus Optical Company ...
-
bioRxiv - Microbiology 2021Quote: ... L454W/E455G and S262R) and mCherry (6:4:1 mixtures; 2.2 μg/well) using Lipofectamine® 2000 (Invitrogen), according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then stained with 1 μg/mL 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes/Thermo Fisher) and analysed on a FACSVERSE (BD Biosciences) ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then stained with 1 μg/mL 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes/Thermo Fisher) and analysed on a FACSVERSE (BD Biosciences) ...
-
bioRxiv - Physiology 2020Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole Dihydrochloride; 1:2000 diluted in PBTD; Thermo Fisher Scientific, Stockholm, Sweden; 62248) was added for 3 minutes followed by washing in PBTD for 25 minutes and mounting with ProLong gold antifade reagent (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... slices were counterstained with 4’,6-diamidine-2’-phenylindole 502 dihydrochloride (DAPI, D3571, Molecular Probes; dilution 1:1000) for 5 minutes followed by 2 minutes wash in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei were counterstained using 4′,6-diamidin-2-phenylindol (DAPI, 1:1000, 7 min; D1306, Thermo Fisher Scientific). Washing steps were performed with PBS ...
-
bioRxiv - Bioengineering 2022Quote: ... the cell nuclei were stained with 1 μg/mL 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific #62248) in DPBS for 15 min at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: ... and pGL4.74-Renilla luciferase plasmids in a ratio of 0.5:1:0.1 (4 μg/6-well dishes) using Lipofectamine LTX PLUS (Invitrogen). The luciferase activity was assayed using the Dual-Luciferase Reporter Assay Kit (Promega) ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were either washed using DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride; 1:10000; Thermo Fisher Scientific, MA) made up in di H2O to stain for nuclei before being mounted or cover-slipped with ProLong Gold mounting medium with DAPI (Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Nuclei were stained by incubation with 0.5 – 1 µg/mL 4’,6-diamidino-2-phenylindole (DAPI, D1306, Invitrogen) in PBS for 10 min at RT ...
-
bioRxiv - Physiology 2023Quote: ... slides were stained with 1:10,000 DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific; Cat. No.: D3571) for 10 min at room temperature before coverslips were applied with PBS and glycerol (1:1 ...
-
bioRxiv - Cell Biology 2024Quote: ... we used 1-(4-Trimethylammoniumphenyl)-6-Phenyl-1,3,5-Hexatriene p-Toluenesulfonate (TMA-DPH; Thermofisher Scientific Cat. No. T204). Yeast cells were stained with 0.5µM TMA-DPH ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclear staining was performed using 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng ml−1; Molecular Probes). Sections were cover-slipped using ProLong Glass mounting agent (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2021Quote: Relative cell proliferation rates were assayed using an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay kit (Vybrant™ MTT Cell Proliferation Assay Kit, Invitrogen™, Thermo Fisher Scientific, cat. no. V13154). Cells were plated in triplicate in a 96-well plate (5,000 cell/well) ...
-
bioRxiv - Cancer Biology 2021Quote: Relative cell proliferation rates were determined using an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay kit (Vybrant™ MTT Cell Proliferation Assay Kit, Invitrogen™, Thermo Fisher Scientific, cat. no. V13154). Cells were plated in triplicate in a 96-well plate (3,000 cell/well in 200 μL of complete medium and cultured under standard conditions for 48 h ...
-
bioRxiv - Cell Biology 2021Quote: ... embryos at the 3-6 somite stage were embedded oriented laterally in 1% low-melt agarose (Invitrogen, Carlsbad, CA) and imaged under bright field (to determine yolk elongation by taking major and minor axis measurements ...
-
bioRxiv - Neuroscience 2019Quote: ... harbouring the full-length cDNA coding for the human muscle 6-phosphofructo-1-kinase muscle isoform (PFK1-M)3 (accession number, NM_000289.1) using Lipofectamine LTX-PLUS Reagent (Life Technologies) according with manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... psPAX2 and pMD2.G with a ratio of 4:3:1 in Opti-MEM (Gibco, 31985070) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... with 1 ml per 4 million cells of 3 mM disuccinimidyl glutarate (DSG) (ThermoFisher Scientific, 20593) for 40 min at room temperature and quenched by 0.4 M Glycine for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... 3% sucrose) diluted 1:4 in Leibovitz’s L-15 medium without phenol red (Gibco, Waltham, MA) and an adjusted osmolality of 340 mOsm using 1 M sucrose ...
-
bioRxiv - Cell Biology 2020Quote: ... and optiMEM (1:6; Gibco) or were left untreated ...