Labshake search
Citations for Thermo Fisher :
4351 - 4400 of 9391 citations for Mumps Virus Nucleoprotein Strain L Zagreb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Equal amounts of the cell lysate protein and equal volume of the virus pellet protein were resolved by SDS-PAGE (NuPAGE 4-12% Bis-Tris gel; Invitrogen/Thermo Scientific) and transferred onto nitrocellulose membrane by semidry transfer ...
-
bioRxiv - Genetics 2022Quote: ... 30 μg of the virus) was digested with 1:100 (w/w) ratios of trypsin (Pierce Trypsin Protease mass spectrometry grade; Thermo Fisher Scientific)/virus for various time points at 25°C (31 ...
-
bioRxiv - Evolutionary Biology 2022Quote: Virus RNA from nasal swabs was extracted from 50 µL of supernatant using the MagMAX-96 AI/ND Virus RNA Isolation Kit (Ambion, Austin, TX) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Reverse transcription (RT) of the extracted RNA samples (1 µg) was performed using AMV (Avian Myeloblastosis Virus) Reverse Transcription Kit (Invitrogen, Waltham, USA) and oligo-dT18 (1 µM ...
-
bioRxiv - Microbiology 2023Quote: Recombinant B19 virus-like particles (VLPs) consisting of VP2 were produced using the ExpiSf™ Expression System Starter Kit (Thermo Fisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The first-strand cDNA was obtained using oligo(dT) primers and Moloney murine leukemia virus-reverse transcriptase (MMLV-RT kit; Life Technologies, USA), using 100 ng of purified RNA ...
-
bioRxiv - Microbiology 2023Quote: ... the first-strand human cDNA was obtained using oligo(dT) primers and Moloney murine leukemia virus-reverse transcriptase (MMLV-RT kit; Life Technologies, USA), and The SuperScript™ VILO™ cDNA Synthesis Kit ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus supernatant was collected after 24 hrs and 48 hrs and filtered with a 0.45-mm syringe filter (Thermo Fisher, CA, USA). pLenti-shCtrl (negative silencing control ...
-
bioRxiv - Neuroscience 2023Quote: ... from the Stanford Gene Vector and Virus core unless otherwise specified) and Ctb retrograde tracers (1 ug/ul; Invitrogen #C34777, #C34776, #C34775) were infused with a syringe pump (Harvard Apparatus ...
-
Enhancing gene transfer to renal tubules and podocytes by context-dependent selection of AAV capsidsbioRxiv - Cell Biology 2023Quote: ... One μg DNA or 4 μL cDNA was used to PCR-amplify virus barcode (VBC) using Platinum SuperFi II DNA Polymerase (12361010, Invitrogen, Waltham, MA). Information on primer sequence including frameshifting nucleotide ...
-
bioRxiv - Microbiology 2023Quote: ... The pooled libraries were mixed with virus-specific 161 biotinylated probes in the presence of human Cot-1 DNA (Invitrogen, Cat#15279011) and xGen Universal Blocking Oligos (IDT ...
-
bioRxiv - Cancer Biology 2022Quote: ... Culture medium was replaced with lentivirus-containing medium at the ratio of 100 μL virus-containing medium per 25,000 cells seeded in the presence of 6 μg/mL polybrene (Thermo Fisher Scientific #TR1003G), followed by centrifugation at 2,000 rpm in room temperature for 30 minutes ...
-
bioRxiv - Immunology 2023Quote: ... These plasmids were co-transfected with MLV (murine leukemia virus)-CMV (cytomegalovirus) luciferase and MLV Gag/Pol plasmids into HEK-293T cells (ATCC CRL-3216) using Lipofectamine 2000 (Thermo Fisher 11668019) transfection reagent following the manufacturer’s recommended protocol ...
-
bioRxiv - Immunology 2022Quote: ... and subjected to the one-step quantitative real-time reverse transcription-PCR assay (qRT-PCR) using TaqMan Fast Virus 1-Step Master Mix (ThermoFisher, Cat# 4444432) as described previously58 ...
-
bioRxiv - Microbiology 2023Quote: ... virus was serially diluted in Vero maintenance media (MEM supplemented with 2% FBS and 1% each of GlutaMax (Gibco, Grand Island, NY), PenStrep ...
-
bioRxiv - Microbiology 2023Quote: ... First-strand cDNA synthesis was performed on 1 µg of total RNA with the RevertAid H Minus Moloney murine leukemia virus (M-MuLV) reverse transcriptase (Thermo Fisher Scientific) using random primers p(dN)6 (Roche) ...
-
bioRxiv - Immunology 2023Quote: ... The next day cells were infected with VSV-GFP virus at multiplicity of infection (MOI) of 1 in serum-free DMEM (DMEM Thermo Fisher, 11965092). After 1hr of incubation with media containing virus ...
-
bioRxiv - Cell Biology 2023Quote: ... The virus supernatant was collected after 24 hrs and 48 hrs and filtered with a 0.45-μm syringe filter (Thermo Fisher, CA, USA); polyethylene glycol (PEG ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We added 50 larvae that have orally ingested half their body lengths of virus solution to 2 25-cell compartmentalized square petri dishes (ThermoFisher Scientific, U.S.A.) with ‘standard’ food and incubated them for 20 days [38] ...
-
bioRxiv - Plant Biology 2024Quote: ... 1.0 μg DNase-treated RNA was reverse transcribed in a reaction volume of 20 μl containing oligo-(dT)19 primer and Moloney murine leukemia virus reverse transcriptase (Thermo Fisher Scientific). RT-qPCR analysis was then performed with 1.0 μl of 5-fold diluted cDNA using a SYBR premixed Ex Taq kit (Takara) ...
-
bioRxiv - Microbiology 2024Quote: ... and after one hour virus was removed and cells were washed in PBS once before replacing culture media (DMEM F-12 (Thermo Fisher Scientific), penicillin (100LIU/ml)/streptomycin (100Lμg/ml ...
-
bioRxiv - Microbiology 2024Quote: ... levels quantitative real-time PCR (RT-qPCR) was performed as previously described22 using TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher, #4444436) and an OneStepPlus Real-Time PCR System (96-well format ...
-
bioRxiv - Cell Biology 2020Quote: ... the MPS3-mCherry C-terminal fusion and the ADH1 terminator was amplified from genomic DNA of a strain harboring the MPS3-mCherry construct and blunt-cloned into the pJET2.1 vector (ThermoFisher). A BglII-BglII fragment from pSS266 containing MPS3-mCherry was then cloned into BamHI of pRS424 to generate pSS267 ...
-
bioRxiv - Molecular Biology 2020Quote: ... mock) or reovirus strains T3SA+ or T3SA-at an MOI of 100 PFU/cell diluted in Opti-MEM (Gibco). Cells were incubated at room temperature (RT ...
-
bioRxiv - Biochemistry 2020Quote: ... The response regulators from Deinococcus radiodurans strain R1 (DrRR, gene DR_A0049) and Agrobacterium fabrum strain C58 (AtRR, gene Atu1989)22 were produced as a service (Invitrogen). The response regulator constructs were cloned into pET21b(+ ...
-
bioRxiv - Neuroscience 2021Quote: ... Constructs were validated by sequencing prior to site-specific recombination with the baculovirus genome provided by its host E.coli strain DH10Bac (Bac-to-Bac-System, Invitrogen). Positive recombinant clones were identified by blue-white screening and further confirmed by PCR ...
-
bioRxiv - Systems Biology 2021Quote: Yeast strains were stained with the red fluorescent dye FM4-64 (excitation/emission, 515/640 nm) (Thermo Fisher Scientific). Exponentially growing cells were incubated at an OD of 0.5-1 in YPD with 2 µM FM4-64 in the dark for 30 minutes at 30°C ...
-
bioRxiv - Microbiology 2021Quote: ... and the cap59Δ mutant (cap59) strains were incubated in YPD medium at 30°C and CO2-independent medium (Gibco) at 37°C until saturation ...
-
bioRxiv - Microbiology 2021Quote: ... pneumoniae strains were grown overnight at 37°C to stationary phase in LB-Lennox broth (Fisher Scientific, BP1427-2) with constant agitation ...
-
bioRxiv - Microbiology 2021Quote: ... and resuspended to OD 1.0 (1 × 109 bacteria/ml, validated by flow cytometry for all individual bacterial strains) in RPMI (Gibco) + 0.05% human serum albumin (HSA ...
-
bioRxiv - Microbiology 2021Quote: ... and H2B.V-over (Y strain) epimastigote forms were maintained in the abovementioned medium supplemented with 500 µg/mL G418 (Gibco) and 500 µg/mL puromycin and the last two lineages with blasticidin 10 μg/mL ...
-
bioRxiv - Microbiology 2020Quote: ... coli K-12 ΔhflX strain was complemented by reintroducing hflX ORF using pBAD replicative plasmid (Invitrogen, CAT No.: V44001) E ...
-
bioRxiv - Cell Biology 2021Quote: The laboratory strain of Leishmania donovani (Dd8) was routinely maintained in high glucose Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Life Technologies) supplemented with 10% of heat-inactivated foetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2022Quote: Prion-infected brain homogenate was prepared by homogenizing 30 brains from female C57Bl/6 mice terminally-infected with the ME7 prion strain in Dulbecco’s phosphate buffered saline lacking Ca2+ or Mg2+ ions (D-PBS; Gibco) to produce a pool of 130 ml 10% (w/v ...
-
bioRxiv - Cell Biology 2022Quote: All recombinant condensin complexes were expressed using insect cell strains from the Bac-to- Bac Baculovirus Expression System (ThermoFisher) as previously described (Kinoshita et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... annulata-transformed counterparts (TBL20, Hissar parasite strain)47 were cultured under the same conditions except that 2-mercaptoethanol (Gibco) was added to the culture medium ...
-
bioRxiv - Biophysics 2021Quote: ... Staphylococcus carnosus: Stock of target strain was incubated at 37°C overnight in anaerobic conditions (AnaeroGen 2.5L, Thermo Scientific) on to LB agar plate then resuspended in 0.9% NaCl ...
-
bioRxiv - Microbiology 2022Quote: ... 10 g tryptone) from a single colony streaked from frozen strain stocks on an LB agar (1.5% w/v SelectAgar, Invitrogen) plate ...
-
bioRxiv - Systems Biology 2020Quote: ... Plasmid DNA from both the ETEC strains was additionally isolated using the Gene Jet Plasmid Miniprep Kit (Thermo Scientific) by following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... the synchronized ΔPfNot1.1 and the parental strain at 24 hpi was incubated in 20 μg/ml actD (Thermo Scientific) or DMSO for 4 hours ...
-
bioRxiv - Microbiology 2019Quote: ... The MamK-like gene from strain Poly30T was amplified by standard PCR procedures with Phusion DNA polymerase (Thermo Scientific) using the primers RPA821_NheI (CTAGCTAGCATGACCGACATC ACGACCGAC ...
-
bioRxiv - Microbiology 2021Quote: ... coli BW25113 cells and an appropriate mutant strain was used to inoculate 150 ml of Lennox LB (Fisher Scientific) and was cultivated to an OD578 of 0.5-0.6 at 37°C before harvesting by centrifugation (4500 × g ...
-
bioRxiv - Microbiology 2021Quote: ... The strains of bacteria were stained with a NucBlue Live ReadyProbes reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... baltica strain #1432 was extracted from 2 mL of overnight culture by Genomic DNA Purification Kit (Thermo Fisher Scientific) according to manufacturer’s protocol for Gram-negative bacteria ...
-
bioRxiv - Biochemistry 2021Quote: Prion-infected brain homogenate was prepared by homogenizing 200 brains from CD-1 mice terminally-infected with the RML prion strain in Dulbecco’s phosphate buffered saline (D-PBS; Gibco) to produce a pool of ~1 litre 10 % (w/v ...
-
bioRxiv - Microbiology 2020Quote: RNA extracted from the KS79 WT strain grown to E and PE phase was treated with DNase (ThermoFisher Scientific). 1 μg of DNase treated RNA was reverse transcribed with Protoscript II (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... cells persistently infected with BoDV-1 strain huP2br 20 were cultured in high-glucose (4.5%) Dulbecco’s modified Eagle’s medium (DMEM) (11965092; Thermo Fisher Scientific) supplemented with 5% fetal bovine serum ...
-
bioRxiv - Microbiology 2021Quote: ... an overnight culture of the parent strain was grown in Todd Hewitt (Beckinson Dickinson) broth with horse serum (Invitrogen), then diluted 200-fold and incubated at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... All strains were grown on Columbia agar supplemented with 7% (v/v) sheep blood (Oxoid™, Thermo Fisher Scientific) overnight at 37°C under aerobic conditions ...
-
bioRxiv - Microbiology 2022Quote: ... cruzi Sylvio X10 strain epimastigotes were grown in Liver Infusion Tryptose medium supplemented with 10% inactivated FBS (Life Technologies)22 at 27°C ...