Labshake search
Citations for Thermo Fisher :
4301 - 4350 of 10000+ citations for TRAP 5 amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... membranes were blocked with 5% BSA (Thermo Fisher Scientific, Cat. # A9647) at room temperature for 1 h and incubated with the indicated primary antibodies overnight at 4°C and secondary antibody for 2 h at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were run and analyzed on a Quantstudio 5 (Applied Biosystems). The qPCR targets were normalized to the expression of the housekeeping gene 36B4.
-
bioRxiv - Microbiology 2023Quote: ... with 5% FBS in NUNC 24-well plates (Thermo Fisher Scientific). Prior to inoculation of cells ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5’- TTGGATCAGCTCAGACATATT-3’ or a nonspecific “scrambled” control (Invitrogen, United States). 72 hours after transfection ...
-
bioRxiv - Physiology 2024Quote: ... cells were detached via a 5 min exposure to Trypsin (Gibco), cell numbers were determined and cells were transferred into a particulate-free reaction tube containing 2.5 % agarose gel ...
-
bioRxiv - Microbiology 2024Quote: ... Columbia agar plates with 5% sheep blood (Thermo Fisher Scientific, PB5039A) were streaked with the corresponding glycerol stocks ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 5% heat-inactivated fetal calf serum (FCS; Life Technologies), 1% penicillin/streptomycin (PS ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μL of 100bp DNA ladder (SM0243, Thermo Fisher Scientific, USA) was added and 10 μL PCR products were added in the remaining wells along with positive and negative control ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μL Proteinase K (10 mg/ml) (Thermo Scientific™, EO0491) were used and incubated at 55°C for 1h with vigorous pipetting every 15 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... the mastermix was made using 5 μL Fast SYBR Green (ThermoFisher), 1 μL of telomere A primer (1 μM) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μl of a 50 mM sulforhodamine-101 (SR-101, Invitrogen/Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 ml additional L-glutamine (Gibco, 25030–081; stock 200 mM), 10 ml MEM nonessential amino acids (Gibco ...
-
bioRxiv - Molecular Biology 2024Quote: ... in a an incubator (37°C, 5% CO2, Thermo Fisher Scientific) for 14 hours to induce ex vivo ovulation ...
-
bioRxiv - Molecular Biology 2024Quote: ... in a Quant Studio 5 Real-Time PCR System (Applied Biosystems, ThermoFischer Scientific AG ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 1X Mammary Epithelial Growth Supplement (MEGS, Invitrogen S-015-5). Mycoplasma contamination was frequently assessed by PCR ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5 µM MitoSOX™ Red (Thermo Fisher Scientific, Waltham, USA) for 30 min ...
-
bioRxiv - Cell Biology 2024Quote: ... All siRNA transfections were performed using RNAiMAX (5 µL; Thermo Fisher) and OptiMEM (400 µL ...
-
bioRxiv - Bioengineering 2023Quote: ... mouse anti-claudin-5 (Invitrogen, cat# 35-2500, AB_2533200, 1:200), rabbit anti-ZO-1 (Invitrogen ...
-
bioRxiv - Plant Biology 2024Quote: ... respectively were stained with EdU (5-ethynyl-2′-deoxyuridine; Thermo Fisher) and modified pseudo-Schiff propidium iodide (PI ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 5 μL of TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific) and 1 μL of cDNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µl of Trypan blue (Thermo Fisher Scientific, cat. no. T10282) was mixed with 5 µl of the sample and loaded onto an INCYTO C-Chip Disposable Hemocytometer ...
-
bioRxiv - Cell Biology 2024Quote: ... All siRNA transfections were performed using RNAiMAX (5 μL; Thermo Fisher) and OptiMEM (400 μL ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μL QuantStudio 3D Digital PCR Master Mix V2 (ThermoFisher Scientific) and 3 μL water for a final volume of 10 μL ...
-
bioRxiv - Immunology 2024Quote: ... 5 mg antibody was reduced with Bond-Breaker TCEP solution (ThermoFisher) for 1 hour at 37°C then desalted with Zeba 7 kDa spin columns to remove TCEP ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 5% fetal calf serum (FCS) (Gibco, Waltham, MA, USA), 0.5 ng/mL of recombinant human fibroblast grow factor-basic (FGF-basic ...
-
bioRxiv - Immunology 2024Quote: ... and the QuantStudio 5 Real-Time PCR Detection System (Thermo Fisher). The Throat Swab sample was analyzed for SARS-CoV-2-specific RNA by quantitative RT-PCR (qRT-PCR) ...
-
bioRxiv - Genomics 2024Quote: ... was dissolved in HPLC grade ethanol (Fisher Scientific, 64-17-5) to a final concentration of 30,000μg/mL and complexed to fatty acid-free (FAF ...
-
bioRxiv - Immunology 2024Quote: ... Tilt series were acquired using Tomography 5 (version 5.5.0; ThermoFisher Scientific) in counting mode at 49,000× magnification with a pixel size of 1.74 Å using a dose-symmetric scheme from 0° to +/-57° ...
-
bioRxiv - Immunology 2024Quote: ... 5 mM β-mercaptoethanol and 500 µg/ml G418 sulphate (Invitrogen)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and stained with 5 μM MitoSOXTM Red (Invitrogen, Cat. No. M36008) in Hank’s balanced salt solution with calcium and magnesium (HBSS/Ca2+/Mg2+ ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 nL of 5 mM TCEP (Thermo Fisher Scientific, Waltham, MA) containing 0.05% n-dodecyl-β-d-maltoside (DDM ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by two 5 min washes in 5x SSC (ThermoFisher, AM9770). Samples were then incubated for 15-30 min in pre-warmed probe hybridization buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... and then 5 µl of CFSE (Life Technologies, Invitrogen, Massachusetts, US) was added to the cell suspension and incubated at 37 °C for 15 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... and then 5 µl of CFSE (Life Technologies, Invitrogen, Massachusetts, US) was added to the cell suspension and incubated at 37 °C for 15 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNAs targeting DHHC 2 and 5 were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM EGTA) supplemented with Halt Protease/Phosphatase inhibitor (Thermo Fisher). Biotinylated proteins were captured using nanolink Streptavidin magnetic beads (Solulink ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 ml (cat no. 89892) were procured from Thermo Scientific (USA). Streptavidin agarose (cat no ...
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with 5% FBS devoid of charcoal (Gibco, ref: 12676-029) during treatment.
-
bioRxiv - Biochemistry 2024Quote: ... 5-(Pentafluorobenzoylamino) Fluorescein Di-β-D-Glucopyranoside (PFB-FDGlu, ThermoFisher Scientific) was used to evaluate GCase activity in live cells ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 uL of supernatant were subjected to DNase digest (ThermoFisher, EN0521) at 37°C for 30 minutes followed by heat inactivation at 65°C for 10 minutes ...
-
bioRxiv - Bioengineering 2024Quote: ... Cultures were maintained for 5 days in DMEM-F12 medium (Gibco) supplemented with 1% N2 (Gibco) ...
-
bioRxiv - Microbiology 2023Quote: ... GlutaMAX™ (Thermo) supplemented with 5% fetal calf serum (FCS, Gibco) and 100 μg/ml penicillin-streptomycin ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 minutes) using a TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems) using specific primers (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.25 ul 10 uM TaqMan probe (5’ TTAGATCCTAGCTCACGTGTC; Applied Biosystems, #5371391), 1 ul DNA template ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μL of 5-fold SYPRO Orange (Thermo Fisher, S6650) was added to each well ...
-
bioRxiv - Cell Biology 2023Quote: ... on a QuantStudioTM 5 real-time PCR system (Thermo Fisher Scientific). The 2- ΔCt method was used to analyze the data using GAPDH and tyrosine 3- monooxygenase/tryptophan 5-monooxygenase activation protein zeta (YWHAZ ...
-
bioRxiv - Immunology 2023Quote: ... cells were incubated with PE-coupled neutravidin (Invitrogen, 5 µg/mL) for 30 minutes at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... and 5 % FBS in neurobasal media (Gibco, Life Technologies #12348-017)) ...
-
bioRxiv - Bioengineering 2023Quote: ... and ABI Quantstudio 5 Detection System (Applied Biosystems, Carlsbad, CA,USA). the reaction volume and conditions were described in previous study (Wu et al ...
-
bioRxiv - Neuroscience 2023Quote: ... 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM; Gibco, 41965-039) supplemented with 10% heat-inactivated FBS ...