Labshake search
Citations for Thermo Fisher :
4251 - 4300 of 10000+ citations for TRAP 5 amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were blocked using 5% non-fat milk (ThermoFisher Scientific 50488785) made with 1% Tris-Buffered Saline Tween20 (TBST ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 μg/mL FM 1-43 (Thermo Fisher Scientific Ref. T35356) to label membranes or 100 nM SiR-DNA (Spirochrome Ref ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 μl of Power SYBR-Green PCR Master Mix (Applied Biosystems) and 0.5 μM of each forward and reverse primer ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by 5 min incubation with 1 mg/ml NeutrAvidin (Invitrogen) in MRB80 buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... in 1XPBS) + 5% normal goat serum (Thermo Fisher Scientific, Berman, Germany). Primary antibody staining was performed at 4°C overnight on an orbital shaker ...
-
bioRxiv - Immunology 2022Quote: ... pre-coated with 5 µg/ml α-CD43 (eBioR2/60, Invitrogen) and α-CD44 (IRAWB14 ...
-
bioRxiv - Genomics 2022Quote: ... 1 μl DRAQ5 (5 mM solution; Thermo Fisher, cat. no. 62251) was added ...
-
bioRxiv - Immunology 2022Quote: ... with DMEM supplemented with 5% FBS (Gibco, Life Technologies, Basel, Switzerland), and the suspension was passed through a cell strainer (70 μm) ...
-
bioRxiv - Immunology 2022Quote: ... Triplicate samples were quantified using the QuantStudio 5 software (Applied Biosystems). Oligonucleotides for selected genes were designed employing the Roche Universal ProbeLibrary Assay Design Center and (Kraja et al. ...
-
bioRxiv - Microbiology 2022Quote: ... BbCRPA 5’ end PCR product that contains EcoRI (FD0274, Thermo Scientific) sites was fused with Bar-BbCRPA3’ to generate pK2-BbCRPA5’-Bar-BbCRPA3’ ...
-
bioRxiv - Microbiology 2022Quote: ... After further incubation with 5 μg/ml puromycin (A11138-03; Gibco) for 2 h at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 mM DTT) and 0.5 μL reverse transcriptase Superscript III (Invitrogen) and mixing quickly with a pipette ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of 45 mM dithiothreitol solution (Invitrogen, Carlsbad, CA, USA) were added and incubated for 15 min at 50°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 µl of SYBR Green PCR master mix (Applied Biosystems) were added in a 10 µl reaction with the following conditions ...
-
bioRxiv - Plant Biology 2022Quote: ... with 5 µl 5X First Strand Buffer (Invitrogen Catalog Number 18067017) and 6 µl nuclease-free water at 37°C for 60 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.3 uL RNAiMax in 5 uL OptiMEM (Gibco, Thermo Fisher Scientific). The cells were seeded into 96-well cell culture plates containing culture medium with DMSO or inhibitors.
-
bioRxiv - Neuroscience 2023Quote: ... qRT-PCRs were run on a QuantStudio 5 system (ThermoFisher Scientific) using SensiFast SYBR Lo-ROX Kit (Meridian Bioscience BIO-94020) ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 μg RNA was treated with TURBO™ DNase (Invitrogen #AM2238) and 500 ng of this was used for cDNA synthesis with oligo-dT primer using RevertAid H Minus First Strand cDNA Synthesis (Thermo Scientific #K1632) ...
-
bioRxiv - Zoology 2022Quote: ... 5 µl 2X Platinum™ Multiplex PCR Master Mix (ThermoFisher Scientific), 1 µl 10X primer mix and 3 µl H2O ...
-
bioRxiv - Microbiology 2022Quote: ... washed 5 times and mounted in Prolong Gold antifade (ThermoFisher Scientific). Samples were imaged on the Zeiss LSM780 confocal microscope.
-
bioRxiv - Cancer Biology 2024Quote: ... and 1X Mammary Epithelial Growth Supplement (MEGS, Invitrogen S-015-5). Mycoplasma contamination was frequently assessed by PCR ...
-
bioRxiv - Neuroscience 2022Quote: ... Saturated cultures were serially diluted 1:5 in sterile PBS (Gibco). To SC –ura -his glucose or galactose agar plates ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 5% FBS and non-essential amino acids (Life Technologies). At 4 d post-transfection ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 μL of TaqMan™ Genotyping Master Mix (Applied Biosystems; 4371353), 0.5 μL of assay probes (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2022Quote: ... in a Quant Studio 5 Real-Time PCR System (Applied Biosystems, ThermoFischer Scientific AG ...
-
bioRxiv - Neuroscience 2022Quote: ... Real-time PCR was performed with QuantStudio™ 5 (Thermo Fisher).
-
bioRxiv - Microbiology 2022Quote: ... using the QuantStudio™5 Real-Time PCR system (Applied Biosystems), which has been described in detail (31) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Multidrop™ Combi Reagent Dispenser (ThermoFisher, green in scheme 1-5) or manually (grey in scheme 1-5).
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5 μl Taq polymerase (5 U/μl; Thermo Scientific; Dreieich, Germany), 1 μl of each primer (10 mM) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 mL additional L-glutamine (GIBCO 25030-081; stock 200 mM), 10 mL MEM nonessential amino acids (GIBCO 11140076 ...
-
bioRxiv - Molecular Biology 2022Quote: qPCR samples were analyzed on a QuantStudio 5 System (Applied Biosystems) with a passive reference of ROX and analyzed by QuantStudio 5 software using the Relative Standard Curve setting.
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were blocked with 5% bovine serum albumin (Thermo Fisher Scientific) in tris-buffered saline with 0.2% Tween®20 (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... the cells were incubated with 5 µM of DeepBlueC (Molecular Probes). The measurements were done with Mithras LB940 (Berthold Technologies ...
-
bioRxiv - Immunology 2022Quote: ... including 5 mg protein and 5000× SYPRO Orange (Invitrogen, Carlsbad, USA) as fluorescence probe ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μg/ml streptomycin was also added (Fisher Scientific, Waltham, MA). Mycobacterium smegmatis (ATCC 700084 ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were blocked with 5% bovine serum albumin (Thermo Fisher Scientific) in tris-buffered saline with 0.2% Tween®20 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... The RNA Sel25 oligonucleotide (5’GGACAGGAAUUAAUAGUAGCUGUCC3’) was obtained from Invitrogen (USA) along with a FITC tagged version on the 5’ extreme ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μL Proteinase K (10 mg/ml) (Thermo Scientific™, EO0491) were used and incubated at 55°C for 1h with vigorous pipetting every 15 minutes ...
-
bioRxiv - Plant Biology 2024Quote: ... respectively were stained with EdU (5-ethynyl-2′-deoxyuridine; Thermo Fisher) and modified pseudo-Schiff propidium iodide (PI ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 5 μL of TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific) and 1 μL of cDNA ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNAs targeting DHHC 2 and 5 were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM EGTA) supplemented with Halt Protease/Phosphatase inhibitor (Thermo Fisher). Biotinylated proteins were captured using nanolink Streptavidin magnetic beads (Solulink ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 ml (cat no. 89892) were procured from Thermo Scientific (USA). Streptavidin agarose (cat no ...
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with 5% FBS devoid of charcoal (Gibco, ref: 12676-029) during treatment.
-
bioRxiv - Biochemistry 2024Quote: ... 5-(Pentafluorobenzoylamino) Fluorescein Di-β-D-Glucopyranoside (PFB-FDGlu, ThermoFisher Scientific) was used to evaluate GCase activity in live cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... and then 5 µl of CFSE (Life Technologies, Invitrogen, Massachusetts, US) was added to the cell suspension and incubated at 37 °C for 15 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... and then 5 µl of CFSE (Life Technologies, Invitrogen, Massachusetts, US) was added to the cell suspension and incubated at 37 °C for 15 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 nL of 5 mM TCEP (Thermo Fisher Scientific, Waltham, MA) containing 0.05% n-dodecyl-β-d-maltoside (DDM ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by two 5 min washes in 5x SSC (ThermoFisher, AM9770). Samples were then incubated for 15-30 min in pre-warmed probe hybridization buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... and stained with 5 μM MitoSOXTM Red (Invitrogen, Cat. No. M36008) in Hank’s balanced salt solution with calcium and magnesium (HBSS/Ca2+/Mg2+ ...