Labshake search
Citations for Thermo Fisher :
4301 - 4350 of 10000+ citations for 6 IODO BENZO D 1 3 OXAZIN 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Lysate was diluted 1:3 in distilled water and digested in 0.2mg/ml proteinase-K (Invitrogen; 25530049) for 10 minutes at 55°C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... + hydrogen peroxidase 3% (1:100, Alexa Fluor 594 Tyramide SuperBoost Kit, Invitrogen, Thermo Fisher Scientific, Ghent, Belgium) + Tris Buffer HCl pH 7,4 (1:1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... at a ratio of 1:3 (µg DNA: µg PEI) in 200 µl Opti-MEM (Gibco, 31985070). Media was replaced after 24h ...
-
bioRxiv - Cell Biology 2024Quote: Cells were washed 2x with PBS and gently dissociated with 1:3 diluted Accutase (Gibco, A11105-01). Lifted cells were washed 2x with cold dPBS (HyClone ...
-
bioRxiv - Neuroscience 2024Quote: ... the slices were incubated in Cyanine 3 (Cy3) goat anti-mouse (Thermo Fisher Scientific, A10521, 1:500) in PBS-Triton X 0.3% ...
-
bioRxiv - Bioengineering 2024Quote: ... glass coverslips were submerged in piranha solution composed of 3:1 sulfuric acid (H2SO4, Fisher Scientific, A300) and 30 wt% hydrogen peroxide (H2O2 ...
-
Direct analysis of ribosome targeting illuminates thousand-fold regulation of translation initiationbioRxiv - Molecular Biology 2020Quote: ... and 3′ biotinylated using the Pierce RNA 3′end biotinylation kit (Thermo Scientific 20160).
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2019Quote: 3’-tRNAs biotinylation was adapted from Pierce RNA 3’-End Biotinylation Kit (Thermo Fisher). Deacylated tRNAs were denaturated in 25% DMSO at 85°C for 5 minutes and directly chilled on ice ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μl were sampled on a 3 well Diagnostika slides (X1XER303B) from Thermo scientific for observation on an Zeiss LSM710 confocal microscope equipped with a Plan-Apochromat 63×/1.4 Oil objective and 405 nm and 488 nm lasers ...
-
bioRxiv - Microbiology 2023Quote: ... 3′RNA-seq libraries were analyzed on a Qubit 3 Fluorometer (Thermo Fisher Scientific) and an Agilent 4200 TapeStation System prior to paired- end sequencing using the HiSeq 2500 system (Illumina).
-
bioRxiv - Neuroscience 2024Quote: ... wells were treated with Caspase-3/7 (CellEvent™ Caspase-3/7 Green, Invitrogen) 1:1000 in treatment media ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 μg DNA and 3 μL Lipofectamine in 300 μl Optimem (Thermofisher Scientific, USA) were used per well containing 700 μl DMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... sense 5’-CUACAAAGCUGAUGAAGAC-3’ and antisense 5’-GUCUUCAUCAGCUUUGUAG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 mg of solid red DiI (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate, Molecular Probes) dissolved in methylene chloride were mixed with 50 mg of tungsten beads (1.3 microns in diameter ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells were diluted to less than 1 ×106 cells/mL in PBS with 3% FBS and incubated in 1:100 EpCAM-APC (Invitrogen, 17-5791-80) or 1:100 IgG-APC isotype control (BioLegend ...
-
bioRxiv - Molecular Biology 2021Quote: ... Membrane was blocked with 5% milk and probed with anti-mAID (1:5,000, MBL Life Science, cat. No. M214-3) or anti-GAPDH-HRP (1:50,000, Invitrogen, cat. No. MA5-15738-HRP). Membranes were visualized with 0.5x ECL (Amersham ...
-
bioRxiv - Bioengineering 2020Quote: ... RT-qPCR was performed on a 1:3 dilution of the extracted RNA using TaqPath™ 1-Step RT-qPCR Master Mix (Thermo Fisher Scientific) with the following forward and reverse primer sequences ...
-
bioRxiv - Neuroscience 2020Quote: ... blocked for 1 hour in 5 % normal donkey serum in 3% PBST and then incubated in chicken anti-GFP (Invitrogen, A10262, 1:1000) overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 x 1 h) and incubated with the secondary antibody (Alexa-labelled goat anti-mouse 555 plus, A32727, Thermo Fisher Scientific, 1:1000), an anti-GFP antibody conjugated with Alexa 488 (A-21311 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Nepa Gene) with 3 µg plasmid DNA and 1 × 106 cells in 100 µl Opti-MEM (1×) Reduced Serum Medium (Gibco® ThermoFisher Scientific). The electroporated cells were cultured in a non-selective complete medium in a 100 mm × 20 mm cell culture dish (Falcon ...
-
bioRxiv - Cancer Biology 2020Quote: ... The assembled PDMS layers were treated with oxygen plasma (100 watt, 1 ccm, 140 torr, 10 seconds) for irreversible bonding to a glass slide (Fisherbrand 1×3”, Fisher Scientific, Pittsburgh, PA). Prior to flow experiments ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were washed three times for 3 minutes and then incubated 1 hour at RT with secondary antibody (1:500, #A21202, #A21449, #A10042, #A32731, Life Technologies, Carlsbad, California) and Hoechst 33342 (1:1000 ...
-
bioRxiv - Biochemistry 2022Quote: ... The wells were washed with 1% BSA/LBB and incubated for one hour with L9393 (1:5000 dilution) in 3% BSA/LBB followed by incubation with Horseradish Peroxidase (HRP)-conjugated anti-rabbit IgG (Invitrogen, 1:5000 dilution) in 3% BSA/LBB for 30 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... pRSV-Rev = 5: 3: 2) were co-transfected into HEK-293T cells at a ratio of 1:1 using lipofectamine 3000 (Invitrogen, USA, Cat: #L3000015). After 48 h ...
-
bioRxiv - Neuroscience 2023Quote: ... An imaging window was constructed from three layers of microscope cover glass (1 x 5 mm, 2 x 3 mm diameter, Fisher Scientific, no. 1) joined with a UV-curable optical glue (NOR-61 ...
-
bioRxiv - Immunology 2023Quote: ... Deposited ECM was fixed by exposure to 100% methanol at −20°C and stained with Alexa Fluor488-conjugated anti-fibronectin (EBioscience, clone FN-3, 1:500 dilution) or Alexa Fluor594-conjugated (Invitrogen, 1:1000 dilution) anti-ColI/III antibodies (EMD ...
-
bioRxiv - Molecular Biology 2024Quote: ... Brain slices were blocked with 5% donkey serum in 0.3% PBS-T for 1 h at RT and then incubated with a sheep anti-GFRAL antibody (1:500, Thermofisher, Cat. PA5-47769) and/or a rabbit anti-c-Fos antibody (1:500 ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of 4 mM resazurin sodium salt (Acros Organics, Belgium), 0.002 U purified Castellaniella defragrans geraniol dehydrogenase ...
-
bioRxiv - Biophysics 2019Quote: Isolated islets were loaded with 4 µM Fluo-4 AM (Invitrogen) for 45min at 37°C in imaging medium (125mM NaCl ...
-
Human immunodeficiency virus-1 induces and targets host genomic R-loops for viral genome integrationbioRxiv - Molecular Biology 2024Quote: ... isolated with Protein A Dynabeads (Invitrogen; 4 h at 4°C), washed thrice with RSB+T ...
-
bioRxiv - Cell Biology 2020Quote: ... in the presence of 100 μg mL-1 tetramethylrhodamine-conjugated 70 kDa dextran (TMR-D; Molecular Probes, Thermo Fisher Scientific). Monolayers were rinsed 3 times with PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... in the presence of 100 μg mL-1 tetramethylrhodamine-conjugated 70 kDa dextran (TMR-D; Molecular Probes, Thermo Fisher Scientific). Monolayers were rinsed 3 times with PBS ...
-
bioRxiv - Molecular Biology 2021Quote: 1×104 A549 cells were grown in poly(D-lysine)-coated borosilicate glass Lab-Tek 8-well chambers (Thermo Scientific) and stained with MitoTracker Green FM (Invitrogen ...
-
bioRxiv - Cell Biology 2019Quote: ... for 1h at room temperature. Sections were stained with primary antibodies against NEO1 (R&D cat. no. AF1079; dilution: 1:100) and Endomucin (ThermoFisher Scientific ...
-
bioRxiv - Bioengineering 2020Quote: ... R&D systems sheep anti-human CD31/PECAM-1 antibody (AF806) and Hoechst 33324 (H3570) were obtained from Thermo Fisher Scientific (Whaltam ...
-
bioRxiv - Cancer Biology 2020Quote: All 2-D monolayer cultures (2-D) were maintained in standard RPMI media supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (Gibco) in tissue-culture treated flasks at 37°C with 5% CO2 ...
-
bioRxiv - Cell Biology 2021Quote: ... 5% CO2 in minimal medium containing 1 part DMEM (4.5 g/L D-Glucose, Pyruvate, L-Glutamine; Invitrogen 11971-025): 1 part DMEM/F12 ...
-
bioRxiv - Neuroscience 2022Quote: ... Cardiac perfusion began with 25mL of chilled 1×PBS (pH 7.4) followed by perfusion of 10mL DiI solution (Sigma Aldrich, D-282, #42364, Invitrogen), and finally perfusion with 25mL of chilled fixative 4% paraformaldehyde ...
-
bioRxiv - Immunology 2020Quote: ... M-014142-00-0005) or non-targeting siRNA Pool #1 (Dharmacon, Horizon Discovery, D-001206-13-05) were transfected using Lipofectamine RNAiMax (Invitrogen), and experiments were performed at 48 hours post-transfection.
-
bioRxiv - Cell Biology 2019Quote: ... 2 mM D-Glucose, 2 mM L-Glutamine, 1 mM Sodium Pyruvate, 140 mM KCl and 20 mM HEPES, Invitrogen) for longer imaging sessions ...
-
bioRxiv - Neuroscience 2020Quote: ... Prior to transfection cells were brought into suspension by trypsinization and resuspension to 0.18 million cells/mL in growth medium (D-MEM, Gibco 10566016; supplemented with 10% Fetal Bovine Serum, Gibco 10270106; 1% Sodium Pyruvate, Gibco 11360039 ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by DAPI staining at a final concentration of 0.5 μg/ml in 1x PBS (1:5000, #D-1306, Life Technologies) and 2 additional washes with PBS ...
-
bioRxiv - Developmental Biology 2019Quote: ... sections were washed in PBS before blocking in PBS-0.1% Triton-10% normal donkey serum (NDS) and overnight incubation with primary antibody (1:50, anti-HuC/D, Molecular Probes) in PBS-0.1% Triton-1% NDS ...
-
bioRxiv - Cell Biology 2021Quote: ... 293-EBNA-1 human embryonic kidney cells expressing full-length human VEGF-D (“293-EBNA-1-VEGF-D cells”) were established previously (36) and cultured in Dulbecco’s modified Eagle’s medium (DMEM, Thermo Fisher Scientific), 10% FBS ...
-
bioRxiv - Immunology 2022Quote: ... cut into small pieces and digested with collagenase D and DNase I for 1 h at 37 °C in HBSS (Gibco). After digestion ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 mM EDTA and 1% BSA in HBSS) and 2μL of 7-aminoactinomycin D (7-AAD, Thermo Fisher Scientific, A1310) at a concentration of 0.1 mg/mL were added ...
-
bioRxiv - Cell Biology 2024Quote: ... Cultures were then allowed to egress for 30 min at 37 °C in media supplemented with 1 μM cytochalasin D (Invitrogen). After incubation ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with 15% fetal bovine serum (FBS; G22133, R&D) supplemented with 1× penicillin-streptomycin (Cat.# 15140-122; Thermo Scientific) at 37 °C ...