Labshake search
Citations for Thermo Fisher :
4151 - 4200 of 4593 citations for 6 Nitrochrysene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... the membranes were stripped for 6 minutes at RT using a Restore Western Blot Stripping Buffer (#21059; Thermo Scientific, Waltham, MA, USA), blocked ...
-
bioRxiv - Biochemistry 2023Quote: ... 6 μL was injected onto an Acclaim PepMap 100 column packed with 2 cm of 5 μm C18 material (Thermo Fisher, 164564) using 0.1% formic acid in water (solvent A) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were rinsed with serum-free RPMI-1640 medium before being transfected with 5 µL of siRNA pool (20 µM) and 5 µL Lipofectamine 2000 in a 6-well plate in 1 mL of antibiotic-free Opti-MEM (Gibco, #31985-062) medium plus 2 mL antibiotic-free cell-culture medium ...
-
bioRxiv - Cell Biology 2024Quote: Live microscopy imaging was performed on cells in 6-weel or 24-well plates using EVOS FLoid Imaging System (Thermo Fisher Scientific) equipped with 20x objective or Eclipse TS100 (Nikon ...
-
bioRxiv - Cell Biology 2024Quote: ... Transfections were performed with 1 µg of the indicated plasmids (6-well plates) by using the Lipofectamine 2000 system (Thermo Fisher Scientific). For transient transfection with siRNA ...
-
bioRxiv - Biophysics 2023Quote: ... These grids were blotted with filter paper for 3∼6 s (100% humidity at 4 °C) in a Vitrobot Mark IV (Thermo Fisher Scientific) and vitrified in liquid ethane at liquid nitrogen temperature ...
-
bioRxiv - Cancer Biology 2023Quote: LN-229 cells were seeded at 2×10^5 cells/well into in 6-well Nunc™ Cell-Culture Treated Multidishes (ThermoFisher, #140675) and incubated overnight in reduced serum media at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... in PBS pH 7.4 or pH 6), HA (Sigma-Aldrich, 9067-32-7, 0.5%–1% w/v in Hanks’ Balanced Salt Solution (Gibco, 14025-050) or Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 × 105 cells were seeded in 6-well plates and immediately transfected with a mixture of 10 μL Lipofectamine2000 (Thermo Fisher Scientific), 6 μL of 20 μM target-specific siRNA (or non-targeting siRNA as control) ...
-
bioRxiv - Immunology 2023Quote: PPQ cells grown in 6-well plates were transfected with 100 nM control or cGAS siRNA (Dharmacon) by RNAiMax (Thermo Fisher Scientific). cGAS knockdown was confirmed by western blot three days later ...
-
bioRxiv - Immunology 2023Quote: ... The pellets were resuspended in 4.5 mL distilled water to which is added 0.5 mL 6% hypochlorite solution (Fisher Scientific Cat# SS290-1) and gently rocked for 1 minute followed by centrifugation (800g for 2 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... Gene expression was quantified on QuantStudio 6 PRO Real-Time PCR System using PowerUp™ SYBR™ Green Master Mix (Applied Biosystems) and gene-specific primers (Table S4) ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were then washed 6×10 minutes in .05M PBS and incubated with both Alexa-Fluor 488 and 555 secondary antibody (1:1000; Thermo Fisher Scientific) in .05M PBS with .1% Triton x100 for 2 hours at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: The total RNA from mouse liver or Hepa1-6 cells was extracted using ISOGEN (Nippon Gene) and reverse-transcribed using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative PCR was performed on an Applied Biosystems QuantStudio 6 Flex Real-Time PCR System using Fast SYBR Green Master Mix (Applied Biosystems, #4385612). The relative gene expression was calculated using the 2−ΔΔCt method with GAPDH as endogenous control for normalization.
-
bioRxiv - Molecular Biology 2023Quote: ... Blood cells were mixed with 6 mls of PBS and 25 mls of this cell suspension was layered on 18 mls of Ficoll-Paque (Fisher Scientific, 17144003) and spun down for 35 mins at 400 x g at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... 1×105 cells were seeded in 6-well plates overnight and transfected with 20-25 pmol of the indicated siRNAs using Lipofectamine 3000 (ThermoFisher Scientific, 13778030) following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... the coverslips were washed with PBS three times before being mounted using ProLong™ Diamond Antifade Mountant with 4′,6-diamidino-2-phenylindole (DAPI; Life Technologies). Images were obtained with Olympus BX61 fluorescence microscope or Zeiss LSM800 laser confocal scanning microscope and processed using cellSens imaging software (Olympus ...
-
bioRxiv - Neuroscience 2023Quote: ... Two clean 6 mm sapphire disks (Technotrade Inc 616-100) were placed per well of 12- well tissue culture plate (Fisher Scientific 720081) and coated with poly-D-lysine (1 mg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cDNA was amplified with ChamQ SYBR qPCR Master Mix (Q311-02; Vazyme, China) using Quant Studio 6 Flex RealLTime PCR System (Life Technologies, USA). The expression values of the target gene were normalized according to the reference gene (GAPDH) ...
-
bioRxiv - Microbiology 2023Quote: ... After the secondary antibody was washed three times for 5 min, nuclei were stained with DAPI (4’,6- Diamidino-2-Phenylindole, Dihydrochloride) (#D1306, Thermo Fisher Scientific) (dilution 1:1,000 in PBS ...
-
bioRxiv - Cell Biology 2023Quote: Cells were seeded onto 6-well plates or 35-mm dishes and transfected at 70–80% confluence with Lipofectamine RNAiMax (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... was used to amplify the genes of interest according to the primers mentioned in the Table 1 from 15-20 ng of cDNA in the QuantStudio 6 Flex Real-Time PCR system (Thermo Fisher Scientific) machine ...
-
bioRxiv - Immunology 2023Quote: ... qPCR was performed using a PowerUp SYBR Green Master Mix and standard protocols on an Applied Biosystems QuantStudio 6 Real-Time PCR System (Thermo Fisher Scientific). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were transfected with 30 pmol of target gene or control siRNA directly after replating on the 6 cm culture plate using Lipofectamine® RNAiMAX (#13778-075, Thermo Fisher), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... sections were stained with 4′,6-diamidino-2-phenylindole (DAPI) for 10 min and mounted using SlowFade Diamond Antifade Mountant with DAPI (Invitrogen, Cat# S36964). Slides were imaged using a Nikon Y-FL microscope attached to a Nikon DS-Qi2 camera and images were captured using NIS elements AR software ...
-
bioRxiv - Neuroscience 2023Quote: ... larvae were visually screened for the expression of single or sparsely labelled FoxP2.A:FingR(PSD95)+ neurons in the tectum using a 20x water-immersion objective and an LSM 980 confocal microscope with Airyscan 2 (Zeiss) and placed into individual wells of a 6-well plates (Thermo Fisher Scientific) to keep track of individual larvae and the corresponding labelled neurons ...
-
bioRxiv - Microbiology 2023Quote: ... 10 x 1 µL droplets of each diluted suspension were deposited on polystyrene material (6-well plates, Thermo Scientific, Cat. No. 140675) and exposed to ambient temperature and variable RH (20% ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected for 6 or 24 hours with Imp1-targeting siRNAs (siRNA #1: s155193, or siRNA #2: s155193. Both from Ambion, Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2023Quote: ... The organoids were quickly transferred into the cold Expansion Medium with Geltrex™ and re-plated into a fresh Pluronic™ F-127-coated 6-well dish (Cat# 140685, ThermoFisher).
-
bioRxiv - Zoology 2023Quote: ... Total RNA was extracted from the pooled intestine tissues of 6 fish in each pond above using TRIzol Regent (Thermo Fisher, USA). Primers were designed based on the coding sequences of these genes from large yellow croaker genome database (Ao et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax-6 and Nkx6.1 (Developmental Studies Hybridoma Bank, Univ. of Iowa) were detected with AlexaFluor labeled secondary antibodies (Life Technologies, Waltham, MA).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Plant Biology 2023Quote: ... 250 ng/ml 4′,6-diamidino-2′-phenylindole dihydrochloride (DAPI) or 500 nM SYTOX Orange (Life Technologies, Thermo Fisher Scientific, Schwerte, Germany) were used as nucleic acid stain.
-
bioRxiv - Bioengineering 2022Quote: ... Dam serum and placental tissue lysates (both prepared as described above) were assayed for IL-6 concentration using an ELISA per manufacturer instructions (Invitrogen, Waltham, MA). Sample absorbance values were compared to a standard curve to calculate IL-6 concentration.
-
bioRxiv - Cell Biology 2022Quote: ... 2’,7’-Bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) was purchased from Molecular Probes (Invitrogen, Carlsbad, CA, USA). Fluorescein isothiocyanate (FITC)- and tetramethylrhodamine (TRITC)-conjugated goat anti-mouse and rabbit IgG antibodies were purchased from Jackson ImmunoResearch (West Grove ...
-
bioRxiv - Systems Biology 2023Quote: ... Macromolecule extractions performed on this cell line as described typically yielded between 450 - 500 µl of soluble extract at 6 - 8 mg/ml of protein as assessed by Bradford assay (Thermo Fisher, #23200). After target capture ...
-
bioRxiv - Microbiology 2022Quote: ... in PBS prior to staining with DAPI (4=,6-diamidino-2-phenylindole) and mounted in Prolong Diamond antifade (Molecular Probes, Life Technologies). Images were captured using a Nikon Eclipse Ti confocal microscope (Nikon Instruments ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative PCR analysis was conducted on an Applied Biosystems QuantStudio™ 6 Flex Real-Time PCR System with Power SYBR Green PCR Master Mix (Applied Biosystems). Expression levels were determined with the delta Ct method and normalized to GAPDH mRNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Culture medium was replaced with lentivirus-containing medium at the ratio of 100 μL virus-containing medium per 25,000 cells seeded in the presence of 6 μg/mL polybrene (Thermo Fisher Scientific #TR1003G), followed by centrifugation at 2,000 rpm in room temperature for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... and 60°C for 20 seconds) in a QuantStudio TM 6 Flex Fast Real-Time PCR System (Life Technologies, Grand Island, NY). Q- PCR was conducted in triplicate for each sample.
-
bioRxiv - Cell Biology 2023Quote: ... Act5C-GS>Ras attP-GFP-LI-Clone 3 and Act5C-GS>Ras attP-GFP-LB-Clone 6 cultures were grown in the same basal media supplemented with 10 nM of Mifepristone (Thermofisher Cat# H11001). Cultures were allowed to grow in T-25 flasks to become confluent before treatment with trypsin (Gibco Cat# 12604013 ...
-
bioRxiv - Cell Biology 2023Quote: ... coated 6-well plates at 5×105 cells/well in RPMI 1640 with B27 and 10% knockout serum replacement (Thermo Fisher Scientific). Cells were expanded by culturing in RPMI 1640 with B27 with 2 μM of CHIR99021 (Stemcell Technologies) ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was isolated from 6 pairs of P21 mouse testes (3 pairs of wild type and 3 pairs of Mov10-/-) using TRIzol reagents (Thermo Fisher Scientific). 1 μg of total RNA from each sample was used to generate RNA-seq libraries using TruSeq Stranded mRNA Library Preparation Kit Set A (Cat ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were transfected with 2ug per well (6 well plate) and 1ug per well (12 well plate) of plasmids concentration with the transfection reagent Lipofectamine 3000 (Invitrogen™, L3000001) and the protocol mentioned in the kit was followed ...
-
bioRxiv - Biochemistry 2023Quote: ... Crosslinking was reversed for 6 h at 70 °C and samples were treated with 200 μg/ml RNase A (Thermo Scientific, EN0531) and 200 μg/ml proteinaseK (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... Fixed cells were stained with 4’,6-diamidino-2-phenylindole (DAPI) for visualization of host-cell nuclei and anti-MOMP antibody conjugated to FITC (Thermo Scientific™) for visualization of Chlamydia ...
-
bioRxiv - Neuroscience 2023Quote: ... and placed in a 6-well cell culture plate filled with 1 ml/well of culture media containing 50% Minimum Essential Medium (MEM, Thermo Fisher Scientific), 23% Earle’s Balanced Salt Solution ...
-
bioRxiv - Biophysics 2022Quote: ... EVs were stained with 5-(and-6)-Carboxyfluorescein diacetate succinimidyl ester (CFDA-SE, hereinafter referred as CFSE) (Thermo Fisher, Catalog No. C1157) and separated as described previously [10] ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3D artificial muscles were fixed with buffered 1% paraformaldehyde (PFA) (ThermoScientific, JI9943.K2) overnight at 4°C followed by 6 hours of blocking at 4°C [10% FBS (Gibco, 10270-106), 1% BSA (Sigma ...