Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for Sialic Acid Binding Ig Like Lectin 5 SIGLEC5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... nickel high binding plates (Thermo Scientific, 15442) were coated with recombinant SARS-CoV2 spike protein (AcroBiosystems ...
-
bioRxiv - Microbiology 2023Quote: ... washed with Annexin V binding buffer (ThermoFisher) and spun down at 470g for 5min ...
-
bioRxiv - Plant Biology 2024Quote: ... Anti-GFP (Invitrogen, A11122, for LHP1 binding), anti-EIN3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pH 7.0) and 2 µg anti-5-methylcytosine (5-mC) antibody (Thermo Fisher, 33D3), and incubated at 4°C overnight with rotation ...
-
bioRxiv - Biochemistry 2020Quote: ... strains were negatively selected against the URA3 marker gene using 1 mg/mL of 5-Fluoroorotic Acid (5-FOA) (Fisher Scientific, F10501-5.0) in SD-plates ...
-
bioRxiv - Cell Biology 2023Quote: ... Purified human neutrophils and T cells were cultured in Human Plasma-Like Medium (HPLM; ThermoFisher Scientific) with 5% heat inactivated FBS supplemented ...
-
bioRxiv - Microbiology 2019Quote: Spotted protein arrays (5 x 6) were printed onto each well of Greiner high-binding 96-well plates (Cat# 655097, Thermo Fisher Scientific) using a sciFLeXARRAYER S12 (Scienion AG ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reaction mixture was left in a heatblock at 22 °C for 5 min before sampling every 30 s into a chilled quenching buffer (binding buffer from Thermo Scientific, K0701). To blunt the digested DNA ...
-
bioRxiv - Genomics 2023Quote: Levels of H3K27ac CUT&Tag binding signal was determined by qPCR amplification carried out with the QuantStudio™ 5 Real-Time PCR System (ThermoFisher A34322) using the Standard Curve experiment type and SYBR Green Master Mix (ThermoFisher 4309155) ...
-
bioRxiv - Cell Biology 2022Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen) at 2 mg/ml in PBS for 10 min or with Laurdan (see above ...
-
bioRxiv - Molecular Biology 2023Quote: ... fixed 5-µm-thick cardiac sections were retrieved with formic acid 70% solution (Thermo Scientific, #270480010) for twenty minutes at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... reconstructed with 5% formic acid (Honeywell|FlukaTM 94318) and desalted with C18 StageTips (Thermo Scientific 87781). Before proceeding with mass spectrometry ...
-
bioRxiv - Developmental Biology 2021Quote: ... The Alexa Fluor 488-conjugated Lectin PNA from Arachis hypogaea (peanut) was purchased from Thermo Fisher Scientific (L21409) ...
-
bioRxiv - Microbiology 2021Quote: ... or 5µg/mL Griffonia simplicifolia IB4-Alexa 488 lectin (Thermo Fisher; kindly provided by Igor Almeida) at room temperature in the dark for one hour ...
-
bioRxiv - Biophysics 2022Quote: ... Peanut agglutinin (lectin PNA from Arachis hypogaea, Alexa Fluor 488 Conjugate, Life Technologies, dilution 1:20), SOX9 (rabbit monoclonal to SOX9 Alexa Fluor 647 ...
-
bioRxiv - Neuroscience 2022Quote: ... Lectin PNA conjugated to Alexa Fluor 488 (1:50) (all from Life Technologies, Grand Island, NY) and DAPI fluorescent die (1:300 ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatants containing shed gp120 were bound to Galanthus nivalis lectin (GNL) beads (Thermo Fisher Scientific). The glycoproteins captured on the beads and the lysates of virus pellets were Western blotted and probed with a goat anti-gp120 antibody ...
-
bioRxiv - Molecular Biology 2019Quote: ... Detection was done using goat-rabbit Ig coupled to Alexa 488 (1:1000; Invitrogen). Cells were incubated with 0.1 μg/mL DAPI and mounted in Poly mount (Polysciences ...
-
bioRxiv - Immunology 2023Quote: ... and an ICAM1 exon 2 (Ig domain 1)-targeting TrueGuide sgRNA (Invitrogen; sequence: CCACAGTTCTCAAAGCACAG) according to the manufacturer’s U2OS protocol ...
-
bioRxiv - Systems Biology 2023Quote: An automated device was built inside a microbiological incubator (Heratherm IGS 100, ThermoFisher Scientific), for fluorescence ...
-
mTOR inhibition enhances delivery and activity of antisense oligonucleotides in uveal melanoma cellsbioRxiv - Cancer Biology 2021Quote: ... The antibodies were diluted in Milk/TBST (5% non-fat dry milk in TBS with 0,1% Tween20) and antibody binding was evaluated using the SuperSignal West Dura Extended Duration Substrate (ThermoFisher Scientific) or SuperSignal West Femto Maximum Sensitivity Substrate (ThermoFisher Scientific) ...
-
bioRxiv - Bioengineering 2020Quote: ... Epitope confirmation was done by a competitive binding assay where saturating concentration of ICR-10 PE antibody (Thermo Fisher Scientific) was coincubated with a concentration gradient of unlabeled E1-1DD or E4-1DD ...
-
bioRxiv - Microbiology 2021Quote: ... The secondary antibody binding was detected by adding 50 μL of tetramethylbenzidine (TMB) peroxidase substrate (cat# 34022, Thermo Fisher Scientific). The peroxidase reaction was terminated by adding 50 μL of H2SO4 (1 M ...
-
bioRxiv - Cancer Biology 2021Quote: ... The antibodies were diluted in Milk/TBST (5% non-fat dry milk in TBS with 0,1% Tween20) and antibody binding was evaluated using the SuperSignal West Dura Extended Duration Substrate (ThermoFisher Scientific) or SuperSignal West Femto Maximum Sensitivity Substrate (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Antibody binding was visualized on CL-XPosure film using ECL SuperSignal West Extended Duration Substrate (both from Thermo Fisher Scientific) or using the Odyssey CLx Imaging System (LI-COR Biosciences) ...
-
bioRxiv - Biochemistry 2021Quote: Four rounds of panning were used to isolate scFvs binding both MERS-CoV S2 and SARS-CoV-2 spike using the following solutions coated on high binding plates: 2 μg/mL anti-c-myc tag antibody (Invitrogen) to eliminate phage expressing no or truncated scFv (Round 1) ...
-
bioRxiv - Immunology 2020Quote: ... Each well was washed and binding of biotinylated monoclonal antibodies was determined with a 1:30000 dilution of HRP-conjugated streptavidin (ThermoFisher). HRP was detected with TMB and stopped with 1% HCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... Binding of the primary antibody was detected by an enhanced chemiluminescence method (SuperSignal™ West Femto, 34094, Thermo Fisher Scientific) using horseradish peroxidase-conjugated secondary antibodies (goat anti-rabbit IgG ...
-
bioRxiv - Neuroscience 2022Quote: ... The beads were freed from storing solution by magnetic separation and then the antibody conjugation performed by adding 200µl of the Ab Binding Buffer (Thermo Fisher), and 5 µg of DCTN1 antibody ...
-
bioRxiv - Pathology 2023Quote: ... Binding of the primary antibody was detected by an enhanced chemiluminescence method (SuperSignal™ West Femto, 34094, Thermo Fisher Scientific) using horseradish peroxidase-conjugated secondary antibodies (goat anti-rabbit IgG ...
-
bioRxiv - Pathology 2023Quote: ... Binding of the primary antibody was detected by an enhanced chemiluminescence method (SuperSignal™ West Femto, 34094, Thermo Fisher Scientific) using horseradish peroxidase-conjugated secondary antibodies (goat anti-rabbit IgG ...
-
bioRxiv - Microbiology 2021Quote: ... 494-bp DNA fragment of the nla28 promoter region containing the putative σ54-RNA polymerase binding site and the Nla28 binding site was cloned into the pCR-Blunt vector (Invitrogen). Site-directed mutations in the putative Nla28 binding site were generated using the Quickchange system (Agilent ...
-
bioRxiv - Immunology 2023Quote: ... antibodies and 5 μg/mL Hoechst 33342 (Molecular Probes) for 2 hours in a humidified chamber protected from light at room temperature ...
-
bioRxiv - Microbiology 2019Quote: ... Caspase-like activity was measure with CellEvent™ Caspase-3/7 Green Flow Cytometry Assay Kit (Invitrogen), a nucleic acid-binding dye that harbors the caspase-3/7 cleavage sequence ...
-
bioRxiv - Bioengineering 2021Quote: Our RGD-containing elastin-like proteins (ELP) are expressed in BL21 (DE3) pLysS Escherichia coli (Invitrogen, 1931008) under control of the T7 promoter ...
-
bioRxiv - Plant Biology 2021Quote: The Trx-like domain and CTD were separately dialyzed in a 10 kDa dialysis card (Thermo Fisher) with the Buffer (25 mM Hepes pH 7.5 ...
-
bioRxiv - Neuroscience 2021Quote: ... NSC34 motoneuron-like mouse hybrid cell line (available in house) was cultured in DMEM (Thermo Fisher Scientific) with 5%FBS (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2021Quote: ... fibroblast outgrowths were dissociated and split 1:4 using a recombinant trypsin-like enzyme (TrypLE Select, Invitrogen). Additional fibroblast preparations were commercially available ...
-
bioRxiv - Neuroscience 2022Quote: Long-term media for cortical-like neurons and sensory neurons consisted of Neurobasal (475mL, Life Technologies 21103049), B27 supplement (10mL ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was extracted from sorted FOXL2+ granulosa-like cells using the Arcturus PicoPure kit (Thermo Fisher), or from COV434 cells and hiPSCs using the Monarch Total RNA Miniprep kit (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... microglia-like cells with intracellular cryptococci were washed with Hank’s Balanced Salt Solution (pH 7.2; Thermo Fisher), and the slides were stained with 0.01% acridine orange (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... The DNA-binding dye Hoescht 33258 (Molecular Probes) was used to visualise cell nuclei ...
-
bioRxiv - Bioengineering 2021Quote: ... maleic anhydride amine-binding wells (Thermo Fisher, 15100) were washed three times with PBS containing 0.05% Tween-20 ...
-
bioRxiv - Cancer Biology 2020Quote: ... an Annexin V binding buffer (Thermo Fisher Scientific) washing step and Annexin V (IQ Products IQP-120R ...
-
bioRxiv - Biochemistry 2022Quote: ... Binding Buffer (100 mM HEPES, pH 7.5 [Gibco] ...
-
bioRxiv - Biophysics 2021Quote: ... cells were resuspended in annexin binding buffer (Invitrogen) containing Ca2+ due to the calcium dependence of the Annexin V:PS interaction ...
-
bioRxiv - Pathology 2020Quote: ... High-binding 96-well plates (Nunc Maxisorp, 442404) were coated with 50 μl per well of 2μg/mL Spike trimer ...
-
bioRxiv - Microbiology 2021Quote: ... High-binding 96-well plates (Nunc Maxisorp, 442404) were coated with 50 μL per well of 2 μg/mL Spike trimer or RBD in 1 x PBS (Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... High-binding 96-well plates (Nunc Maxisorp, 442404) were coated with 50 μl per well of 2 μg/ml Spike trimer or RBD in 1x PBS (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5ml of AAV8-binding slurry beads (ThermoFisher #A30789), enough to purify AAV from three 15cm dishes ...