Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for 6 ETHYL 2 METHYLQUINOLINE 3 CARBOXYLIC ACID ETHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... tryptic peptides obtained from StageTip-based SCX fractionation were reconstituted in 0.1% formic acid and loaded on a nanoViper 2 cm (3 µm C18 Aq) trap column (Thermo Fisher Scientific). Peptide separation was carried out using EASY-Spray C18 analytical column (50 cm ...
-
bioRxiv - Microbiology 2022Quote: ... Amino acids were extracted on ice-cold lysis buffer [5:3:2 ratio of methanol-acetonitrile-water (Fisher Scientific, Pittsburgh, PA)] containing 3 µM of amino acid standards [Cambridge Isotope Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... 0.1% Triton X-100 in PBS for 20 minutes, then were actin stained with DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride) nucleic acid stain (Thermo Fisher Scientific, USA) in PBS for 10 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Nuclei were counterstained with Hoechst 33342 DNA dye NucBlue® Live ReadyProbes® reagent for live cell imaging or 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI) and SYTO® 60 fluorescent nucleic acid stain for fixed samples (Invitrogen, Molecular Probes, Germany).
-
bioRxiv - Cancer Biology 2021Quote: ... Germany) and 2 drops of glacial acetic acid (#3738.1; Roth, Karlsruhe, Germany) in 70% EtOH (#200-678-6, Fisher Scientific, Waltham, Massachusetts, USA) for 30 s and subsequently rinsed in aqua bidest ...
-
bioRxiv - Molecular Biology 2022Quote: ... All sections were mounted with 50μl of ProLong Gold Antifade mounting media containing a fluorescent nucleic acid dye 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, P36931) before imaging ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 2 mM essential amino acids (Invitrogen), 10 units.ml−1 penicillin ...
-
bioRxiv - Immunology 2020Quote: ... containing 2 mM ethylenediaminetetraacetic acid (EDTA; Invitrogen AM9261), 2 mM L-glutamine (Gibco 25030) ...
-
bioRxiv - Immunology 2022Quote: ... nonessential amino acids (Cellgro) and 2-mercaptoethanol (Gibco). Cells were stimulated with 50 ng/mL PMA plus 100 ng/mL Ionomycin (Cell Stimulation Cocktail ...
-
bioRxiv - Immunology 2023Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Invitrogen) and 2-mercaptoethanol (Gibco) ...
-
bioRxiv - Immunology 2021Quote: ... and 1% HEPES (N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid; Gibco). Wild type SARS-CoV-2 (isolate USA-WA1/2020) ...
-
bioRxiv - Immunology 2022Quote: ... 20 mM N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid (HEPES, Gibco) and 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2022Quote: ... and 1% HEPES (N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid; Gibco). Wild type SARS-CoV-2 (isolate USA-WA1/2020 ...
-
bioRxiv - Cancer Biology 2023Quote: Rhodamine tubulin was generated by labeling tubulin with X-rhodamine SE (5(and-6) carboxy-X-rhodamine succinimidyl ester) dye (ThermoFisher). Labeling stoichiometry was determined using a molar extinction coefficient of 115,000 M-1 cm-1 for tubulin and 78,000 M-1 cm-1 for X-rhodamine [58] ...
-
bioRxiv - Cell Biology 2021Quote: ... were transiently transfected into 8 × 104 U2OS 2-6-3 cells in 4-well chamber slides using Lipofectamine 2000 reagent (Invitrogen, 11668019) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... Total DNA was stained using 4’,6-diamidino-2- phenylindole (DAPI) diluted 1:10000 in PBS containing 3% BSA (Molecular Probes) to illuminate host cell nuclei ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TNFα (10 ng/ml) for 6 h and stained for cleaved Caspase 3/7 green (5 µM) and propidium iodide (2 µM) (Thermo Scientific) for an additional 30 min ...
-
bioRxiv - Neuroscience 2020Quote: Cultured DRG neurons (18-48 hours) were loaded with 2.5 μM Fura-2-acetoxymethyl ester (Fura-2; Invitrogen, ThermoFisher Scientific, #F1221) in 0.01% pluronic F-127 (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: Cultured DRG neurons (18-48 hours) were loaded with 2.5 μM Fura-2-acetoxymethyl ester (Fura-2; Invitrogen, ThermoFisher Scientific, #F1221) in 0.01% pluronic F-127 (Invitrogen ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Biochemistry 2022Quote: ... and MBL was labeled with Alexa Fluor 555 NHS Ester (Succinimidyl Ester) (ThermoFisher Scientific) following manufacturers protocol as follows ...
-
bioRxiv - Microbiology 2024Quote: ... Phage solutions were incubated with Alexa Fluor 555 NHS Ester (Succinimidyl Ester, ThermoFisher Scientific) at a concentration of 100 µM for 2 h at room temperature protected from light ...
-
bioRxiv - Biochemistry 2024Quote: ... protein samples were labelled with Alexa Fluor™ 555 NHS Ester (Succinimidyl Ester) (ThermoFisher). The dye was diluted in DMSO (Dimethyl sulfoxide pure ...
-
bioRxiv - Physiology 2020Quote: ... and incubated with 100 mM 6-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (6-NBDG) (Life Technologies) in 10 nM Tris/HEPES buffer containing 150 mM KCl or 150 mM NaCl for 30 minutes at 37 °C ...
-
bioRxiv - Immunology 2019Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, ThermoFisher).
-
bioRxiv - Microbiology 2021Quote: ... 10 mM Laurdan (6-Dodecanoyl-2-Dimethylaminonapthalene, Invitrogen) stock solution was prepared in 100% dimethylformamide (DMF ...
-
bioRxiv - Neuroscience 2019Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Life Technologies) staining was added to visualize nuclei.
-
bioRxiv - Bioengineering 2022Quote: ... 6-diamidino-2-phenylindole (Thermo Fisher Scientific, D1306) for 45 minutes at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... 6-Diamidine-2’-phenylindole dihydrochloride (DAPI, Molecular Probes).
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6- diamidino-2-phenylindole (DAPI; Invitrogen D1306) was added during the secondary antibody incubation at a concentration of 700 ng/ml ...
-
bioRxiv - Microbiology 2020Quote: ... 6 diamidino-2-phenylindole (DAPI) (ThermoFisher scientific, 10116287) and mounted with Fluoromount-G (Cambridge Bioscience) ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-diamidine-2′-phenylindole dihydrochloride (Thermo Fisher Scientific) was added for nuclear counterstaining ...
-
bioRxiv - Bioengineering 2022Quote: ... 2-6 mL (Thermo Scientific, catalog no. 88516), and the final protein concentration was measured via A280 absorbance.
-
bioRxiv - Neuroscience 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) and then washed before mounting with FluorSave (Calbiochem).
-
bioRxiv - Microbiology 2020Quote: ... 6-diamidino-2-phenylindole dihydrochloride (DAPI, Thermofisher Scientific). The mountant was allowed to cure overnight and coverslips were analysed on an Olympus FV3000 confocal microscope.
-
bioRxiv - Cell Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) and then washed before mounting with a FluorSaveTM reagent (Merck-Millipore).
-
bioRxiv - Pathology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI) (Life Technologies, USA). Samples were visualized with a fluorescence microscope (Olympus ...
-
bioRxiv - Pathology 2021Quote: ... 4’,6-Diamidino-2-phenylindole (DAPI, D21490, ThermoFisher) stain was done for 15 min at 4°C ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 6 mM L-glutamine (2 mM from Gibco 31600-091 and 4 mM from additional Gibco 25030-081) ...
-
bioRxiv - Immunology 2021Quote: ... and 4’,6-Diamidino-2-Phenylindole (DAPI, Invitrogen). Confocal analyses of stained slides were performed using a TCS SP8 Laser Scanning Spectral Confocal Microscope (LEICA Microsystems) ...
-
bioRxiv - Molecular Biology 2019Quote: ... DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher) and ActinRed™ 555 ReadyProbes™ (Molecular Probes ...
-
bioRxiv - Microbiology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) at 37 °C for 10 min ...
-
bioRxiv - Neuroscience 2022Quote: DAPI (4′,6-diamidino-2-phenylindole, D1306, Invitrogen) staining was performed by incubation at 1:500 for 10 min in DPBS ...
-
bioRxiv - Immunology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (Life Technologies, 62248) was used to eliminate dead cells ...
-
bioRxiv - Neuroscience 2022Quote: ... DAPI (4’, 6-diamidino-2-phenylindole, ThermoFisher Scientific) was applied to samples at a concentration of 0.1μg/ml ...
-
bioRxiv - Biophysics 2023Quote: ... and 6-dodecanoyl-2-dimethylaminonaphthalene (LAURDAN) from Thermofisher Scientific (USA) ...
-
bioRxiv - Immunology 2023Quote: ... 2-6 mL (Thermo Fisher Scientific/ Pierce, 88521) Pierce™ Protein Concentrators PES ...
-
bioRxiv - Cancer Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific). IHC and IF stained slides were imaged using the Olympus BX53F epifluorescence microscope (Center Valley ...
-
Polarized Mechanosensitive Signaling Domains Protect Arterial Endothelial Cells Against InflammationbioRxiv - Cell Biology 2023Quote: ... Laurdan dye (6- Dodecanoyl-2-Dimethylaminonaphthalene) (Invitrogen #D250) was applied at 10 μM to cell monolayers and incubated 30 min at 37°C then washed and imaged in 1X HBSS ...
-
bioRxiv - Cell Biology 2023Quote: ... 6 diamidino-2-phenylindole (DAPI; ThermoFisher Scientific, 10,116,287) and mounted on slides with Fluoromount-G from Southern biotech (ThermoFisher Scientific ...