Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for 6 ETHYL 2 METHYLQUINOLINE 3 CARBOXYLIC ACID ETHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... Libraries were cleaned up using CA-magnetic beads (Dynabeads® MyOne Carboxylic Acid, Invitrogen), and 17% PEG 6000 (Sigma-Aldrich © LLC) ...
-
bioRxiv - Microbiology 2021Quote: ... 1,2-Bis(2-aminophenoxy)ethane-N,N,N’,N’-tetraacetic acid tetraacetoxymethyl ester (BAPTA-AM, Invitrogen), calcium Ionophore A23187 (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... PAA gel surface activation reagents were ethyl(dimethylaminopropyl) carbodiimide (EDC) and N-hydroxysuccinimide (NHS) solution (Fisher Scientific). Collagenase from Clostridium histolyticum was purchased from Sigma.
-
bioRxiv - Genetics 2019Quote: FluoZin-3 acetoxymethyl ester (Molecular Probes F24195) was reconstituted in dimethylsulfoxide (DMSO ...
-
bioRxiv - Cell Biology 2019Quote: ... By adding a tracer dye (0.5 μg/mL Alexa Fluor 647 carboxylic acid; Life Technologies) to the sorbitol-supplemented medium ...
-
bioRxiv - Molecular Biology 2020Quote: ... Dynabeads MyOne™ Carboxylic Acid and 100mM of each dNTP were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... brains were washed trice with PBS for 5 min and free amines were anchored with 0.1mg/mL succinimidyl ester of 6-((Acryloyl)amino)hexanoic acid (Acryloyl-X, SE, Life Technologies) in PBS at 4°C overnight ...
-
bioRxiv - Cell Biology 2019Quote: ... in PBS was incubated with 86.1μl of Sulfo-NHS-SS-Biotin (sulfosuccinimidyl-20(biotinamido)ethyl-1,3-dithiopropionate) (8mM) (Thermo Scientific) for 2 hrs at 4°C ...
-
bioRxiv - Biochemistry 2019Quote: ... SDC removal was performed by four subsequent liquid-liquid extractions with 300 µL of ethyl acetate (Fisher Scientific), shaking by hand ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated for 20 min at 37°C with tetramethylrhodamine-ethyl-esther (TMRE, 20 nM, Thermo Fisher) and MitoTrackerGreen (MTG ...
-
bioRxiv - Cell Biology 2024Quote: ... the conversion of non-fluorescent 2’,7’-bis-(2- carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF AM) (Invitrogen, Waltham, MA) into a pH sensitive fluorescent indicator by the intracellular esterase was used to measure the pH ...
-
bioRxiv - Cell Biology 2021Quote: ... Wnt3a proteins were immobilized to 2.8 μm carboxylic acid–coated Dynabeads® (cat. num. 14305D, ThermoFisher), as described before (Habib et al. ...
-
bioRxiv - Genomics 2021Quote: ... Size-selection and cleanup were accomplished using CA-magnetic beads (Dynabeads® MyOne Carboxylic Acid, Invitrogen), and 11-11.5% PEG 6000 (Sigma-Aldrich © LLC) ...
-
bioRxiv - Biophysics 2023Quote: ... Carboxylated 1 μm paramagnetic beads were obtained from Thermo Fischer (Dynabeads MyOne Carboxylic Acid, ThermoFisher, USA). 5 μl of the bead solution were centrifuged ...
-
bioRxiv - Bioengineering 2024Quote: ... Concentration of C2 to C6 carboxylic acids and alcohols were analyzed by gas chromatography (Thermofisher, USA) using a Stabil-wax™ column with a length of 25 m and internal diameter of 0.2 μm ...
-
bioRxiv - Microbiology 2023Quote: ... Substrate 2,2’-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt (ABTS; Thermo Fisher Scientific) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... 2’,7’-Bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) was purchased from Molecular Probes (Invitrogen, Carlsbad, CA, USA). Fluorescein isothiocyanate (FITC)- and tetramethylrhodamine (TRITC)-conjugated goat anti-mouse and rabbit IgG antibodies were purchased from Jackson ImmunoResearch (West Grove ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Molecular Biology 2021Quote: ... and FURA 2-AM (Fura-2-acetoxymethyl ester) from Invitrogen, CA ...
-
bioRxiv - Plant Biology 2022Quote: ... Each sample was incubated with 50 µm of 2’,7’-Bis-(2- carboxyethyl)-5-(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM; Molecular Probes, Eugene, OR) at 28°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 2 μM Fura-2 acetoxymethyl ester (Fura-2 AM; ThermoFisher Scientific) and 0.01% pluronic acid (Merck ...
-
bioRxiv - Cell Biology 2023Quote: Tubulin was labelled with (5(6)-TAMRA Succinimidyl Ester (Invitrogen, C1171) for fluorescence microscopy assays according to published methods (Consolati et al ...
-
bioRxiv - Microbiology 2019Quote: ... 100 µL of culture supernatants or BALF were extracted twice with 100 µL of ethyl acetate and concentrated to 20 µL in a 60 Hz Savant SpeedVac DNA 100 concentrator (ThermoFisher Scientific). 1 µL of culture supernatants or 7.5 µL of BALF samples were spotted onto aluminum-backed C18-W silica plates (Sorbent Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... proteins were crashed out by addition of 300 µl ethyl acetate and all samples were evaporated to dryness in a SpeedVac vacuum concentrator (SPD131DDA SpeedVac Concentrator; Thermo Scientific). Dried samples were stored at −20C until further processing ...
-
bioRxiv - Neuroscience 2022Quote: Fura-2 pentaacetoxymethyl ester (fura-2/AM) was from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Developmental Biology 2023Quote: ... Bis-(1,3-diethylthiobarbituric acid) trimethine oxonol (DiSBAC, relative polarization) and CoroNa green, acetoxymethyl ester (CoroNa, sodium ions) were purchased from Invitrogen (Waltham, MA).
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2023Quote: The ROS dye assay was performed using Di(Acetoxymethyl Ester) (6-Carboxy-2’,7’-Dichlorodihydrofluorescein Diacetate) ROS dye (Invitrogen, D23844), a fluorogenic dye that is converted to 6-CarboxyFluorescein ...
-
bioRxiv - Pathology 2021Quote: ... pentaacetoxymethyl ester (Fluo-3/AM) (Molecular Probes, Eugene, OR, USA), which was observed with the laser-scanning confocal microscopy (LSCM ...
-
bioRxiv - Biochemistry 2021Quote: ... 3-[p-(6-phenyl)-1,3,5-hexatrienyl] phenylpropionic acid was purchased from Molecular Probes (Eugene, OR, USA) and 1-stearoyl-2-linoleoyl-sn-glycerol-3-phosphocholine (SLPC ...
-
bioRxiv - Microbiology 2022Quote: Metabolites were extracted from cultures using both liquid-liquid extractions with ethyl acetate (EtOAc) and solid-phase extractions (SPE) using HyperSep™ C18 Cartridges (100 mg bed weight) from Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Biophysics 2020Quote: Recombinant GST-tagged PH-domain of PLCd detecting the membrane lipid PI(4,5)P2 was produced and conjugated to of amine-reactive Alexa Fluor 647 carboxylic acid succinimidylester (Invitrogen) as previously described49 ...
-
bioRxiv - Cancer Biology 2023Quote: Cyclic RGD conjugated MPIO were prepared using 1 μm diameter Dynabead MyOne carboxylic acid MPIO (65011, Fisher Scientific, UK). MPIO were washed in MES buffer and resuspended ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Cardiomyocytes were loaded with Fura-2 acetoxymethyl ester (Fura-2 AM; Invitrogen) as described previously.28 After Fura-2 loading ...
-
bioRxiv - Immunology 2022Quote: ... 100 μg of HDM or OVA were reconstituted in PBS with 0.1 M sodium bicarbonate at 1 mg/ml and mixed with 18 μg Texas Red-succinimidyl ester or 36 μg 5,(6)-TAMRA-succinimidyl ester (Life Technologies), respectively ...
-
bioRxiv - Biophysics 2022Quote: ... Fura-2-acetoxymethyl ester (Fura-2AM, Molecular Probes; Invitrogen), in culture medium for 25 min at 37 °C ...
-
bioRxiv - Biophysics 2022Quote: ... Fura-2-acetoxymethyl ester (Fura-2AM, Molecular Probes; Invitrogen), in culture medium for 25 min at 37 °C ...
-
bioRxiv - Immunology 2020Quote: ... plates were incubated with 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) substrate (ABTS, Thermo Fisher Scientific) for 15 min at RT shielded from light and absorbance was measured at optical density (OD ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 L-malic acid and 20 μM tetramethylrhodamine methyl ester (TMRM, Thermo Fisher) for 10 minutes ...
-
bioRxiv - Physiology 2023Quote: ... with or without 0.1uM 6-Hydroxyhexanoic acid (6-HHA, ThermoFisher, B24857.03).
-
bioRxiv - Cell Biology 2022Quote: ... Fluorescently tagged G-actin was prepared by covalent modification with Alexa Fluor™ 594 Carboxylic Acid (Thermo Fisher Scientific 15461054) (Alvarado and Koenderink ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Myocytes were then loaded with Fura-2 acetoxymethyl ester (Fura-2 AM; Invitrogen) as described previously (Batiste et al. ...
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...
-
bioRxiv - Microbiology 2019Quote: ... Coverslips were stained with 300 nM 4’,6-diamidino-2-phenylindole nucleic acid stain (DAPI; Invitrogen) in PBS for 5 min followed by washing three times in PBS at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... with or without N-ethyl-N-nitrourea 10μg/ml or 50μg/ml and treated 2h with 1mg/ml Collagenase type IV (Gibco by life technologies ref 17104-019).
-
bioRxiv - Molecular Biology 2023Quote: ... and brain tissues were weighed and homogenized at a density of 140 mg of dry tissue per milliliter in ethyl acetate / isopropanol (4:1) using a Bead Mill 4 homogenizer (Thermo Fisher Scientific, Waltham MA) and 2-mL pre-filled polypropylene microtubes (2.8 mm ceramic beads ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...