Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for 6 Chloro N 5 ethoxy 1H pyrazol 3 yl 3 nitropyridin 2 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... or a 1:1 mixture of two siRNA to CHMP2A (5’-CAGGCCGAGAUCAUGGACAUG-3’ and 5’-GAAGAUGAAGAGGAGAGUGAC-3’) using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the reverse primer containing the Sp6 promoter (5’ ATTTAGGTGACACTATAGCCTCTTCAGTTCCTTCTTCCATC-3’).The aqp1a.1 probe was generated from whole extracted cDNA at 30hpf and amplified with the primers (5’-GTCATGAACGAGCTGAAGAGC-3’) and (5’-GGGTCACTTTGAGGACATCTC-3’),incorporated into the pCR-BluntII-TOPO vector (Invitrogen, 45-0245) (containing both the SP6 and T7 promoters) ...
-
bioRxiv - Genomics 2020Quote: ... The 16S rRNA gene was amplified from the extracted genomic DNA using 16S universal primers 27F (5’-AGA GTTTGATCMTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTTC-3’) and sequenced using an automated ABI3730XL capillary DNA sequencer (Applied Biosystems, USA) for taxonomic identification at Cosmo Genetech (Seoul ...
-
bioRxiv - Microbiology 2020Quote: ... 229E-RP reverse primer (5’-CCAACACGGTTGTGACAGTGA-3’) and the TaqMan minor groove binder (MGB) probe 229E-TP (FAM-5’-TCCTGAGGTCAATGCA-3’-NFQ-MGB; Thermo Fisher Scientific), derived from the HCoV 229E membrane protein gene sequence as described previously (Vijgen et al. ...
-
bioRxiv - Microbiology 2021Quote: The mcr-1 gene was amplified from the clinical isolate ESBL20150072 (European Nucleotide Archive, accession number; SAMEA104060671) using primers: 5’-TTTTGGATCCCGGTTTTCGGGCTTTTTA-3’ and 5’-ATATGTCGACTCAGCGGATGAATGCGGT-3’ and Phusion polymerase (Thermo Fisher Scientific). PCR product was digested with BamHI and SalI and ligated into pACYC184 digested with the same enzymes (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2021Quote: ... PCSK9 mRNA expression was assessed by real-time PCR using PCSK9 primer sets 5’-TGTCTTTGCCCAGAGCATC-3’ and 5’-GTCACTCTGTATGCTGGTGTC-3 (Integrated DNA Technologies) and SYBR Select Master Mix (ThermoFisher, ABI 4472908).
-
bioRxiv - Genetics 2022Quote: ... 5’-GGCAAGCUGACCCUGAAGUdTdT-3’ / 5’-ACUUCAGGGUCAGCUUGCCdTdT-3’ or with a hsa-miR-34a mimic duplex: 5’-P-UGGCAGUGUCUUAGCUGGUUGUU-3’ / 5’-P-CAAUCAGCAAGUAUACUGCCCUA-3’ according to the protocol for Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific).
-
bioRxiv - Plant Biology 2021Quote: ... a fragment containing 2.21 kb upstream regulatory region of ELF3 was amplified from Col-0 genomic DNA using primers ELF3Prom-Fw (5’-CACCCTTATAAATAAAATTCC-3’) ELF3Prom-Rv (5’-CACTCACAATTCACAACCTTTTTC-3’) and cloned into the Gateway System (pENTR™ Directional TOPO® Cloning kit, Invitrogen) to obtain the pELF3-TOPO plasmid ...
-
bioRxiv - Cancer Biology 2019Quote: ... (5’-CUAUGAACAUAAAGUCUGCTT-3’) or its non-specific control (5’-UUCUCCGAACGUGUCACGUTT-3’) were transfected into cells using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA).
-
bioRxiv - Neuroscience 2021Quote: ... Drosophila dSF2 sequence was PCR amplified (dSF2 F 5’-CACCATGGGATCACGCAACGAGTGCCG-3’ and dSF2 R 5’- ATAGTTAGAACGTGAGCGAGACCTGG-3’) was cloned into pEntry-TOPO vector (Thermo Fisher Scientific). The pENTR-dSF2 vector was recombined with Gateway plasmid pTWH (Drosophila Genomics Resource Center ...
-
bioRxiv - Immunology 2022Quote: ... targeting SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA using RNAiMAX (ThermoFisher, 13778-075). 24 h after transfection ...
-
bioRxiv - Microbiology 2022Quote: ... The 16S rRNA gene was amplified with the primers 8f (5′-AGAGTTTGATCCTGGCTCAG-3′; Weisburg et al. 1991) and 1520 r (5′-AAGGAGGTGATCCAGCCGCA-3′; Edwards et al. 1989) (Invitrogen, CA, USA). A volume of 0.5 μL DNA extract was used for 50 μL PCR reactions containing 2 units Taq DNA polymerase ...
-
bioRxiv - Microbiology 2024Quote: ... Purified cDNA was amplified for 25 cycles with VSG specific primers: a spliced-leader (5’-ACAGTTTCTGTACTATATTG-3’) and SP6-VSG 14-mer (5’-GATTTAGGTGACACTATAGTGTTAAAATATATC-3’) using Phusion polymerase (Thermo Scientific, F530L) (annealing temp 55C ...
-
bioRxiv - Microbiology 2024Quote: ... 2uL of RNase-treated cDNA was amplified for 35 cycles with VSG specific primers: a spliced-leader (5’-ACAGTTTCTGTACTATATTG-3’) and SP6-VSG 14-mer (5’-GATTTAGGTGACACTATAGTGTTAAAATATATC-3’) using Phusion polymerase (Thermo Fisher, F530L) (annealing temp 55C ...
-
bioRxiv - Cell Biology 2024Quote: ... For SNX5 and SNX6 the following siRNA sequences were used: SNX5 (5′-UUAGUUUCAGCCCGAAGCAUC-3’), SNX6 (5′-UUAUGAGGUAGACGACUAAAU-3’) (Wassmer et al., 2007), VPS35 (ID 132357, AM16708) (Predesigned – Thermo Fisher Scientific). Nontargeting control siRNA (control ...
-
bioRxiv - Microbiology 2024Quote: ... was added at a 1:2000 dilutions for 1 h at 37 °C, followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Fisher Scientific) for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μM of 20-base model RNA (5’-AAUCUAUAAUAGCAUUAUCC-3’; ThermoFisher Scientific) was treated with 300 nM of purified recombinant SARS-Cov2 NSP13 with an N-terminal His-tag (Cayman Chemicals #30589 ...
-
bioRxiv - Immunology 2023Quote: ... and activated with a mixture of 400 mM 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride and 100 mM N-hydroxysuccinimide (Thermo Fisher Scientific). The activated chip was lawned with goat anti-human IgG Fc (50 µg/mL ...
-
bioRxiv - Immunology 2023Quote: ... and activated with a mixture of 400 mM 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride and 100 mM N-hydroxysuccinimide (Thermo Fisher Scientific). The activated chip was coupled directly to mAbs diluted to 10 µg/mL in 10 mM sodium acetate (pH 4.5 ...
-
bioRxiv - Microbiology 2023Quote: ... The chip was activated with a freshly prepared solution of 130 mM 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) (Pierce PG82079) and 33 mM N-hydroxysulfosuccinimide (Sulfo-NHS) (ThermoFisher Scientific 24510) in 0.1 M MES pH 5.5 using the SFC ...
-
bioRxiv - Microbiology 2023Quote: ... The chip was activated with a freshly prepared solution of 130 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (Pierce PG82079) and 33 mM N-hydroxysulfosuccinimide (Sulfo-NHS) (ThermoFisher Scientific 24510) in 0.1 M MES pH 5.5 using the SFC ...
-
bioRxiv - Immunology 2024Quote: ... and SB28 RRV-IRF8 (100% transduced) cells were plated at 1x105 cells (n=3 per time point) and counted (Thermofisher Countess 3)at 24 and 48 hours post-seeding ...
-
bioRxiv - Cell Biology 2020Quote: ... and Y14 siRNA (5’-GGGUAUACUCUAGUUGAAUUUCAUAUUCAACUAGAG-3’) with Lipo2000 (Invitrogen) in Optimem (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... siDDX42-4: 5’-AUCUCGAAUACCCUUUACG-3’ (ID:136410, Ambion®).
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion) 5’-UGAUUAGUGAUUACCACUGCT-3’ RRM1 (On-Target plus SMARTpool – Dharmacon)
-
bioRxiv - Genetics 2024Quote: ... 5′-UUAAUUUACGCGGUUUUUAUU-3′) using the RNAiMAX transfection reagent (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... or 5’-TCAAGGTCCCTGATAATTATGGCGA-3’) or scrambled siRNA (non-targeting control) using 6 μL Lipofectamine™ RNAiMAX (Invitrogen™ - Cat.# 13778075). After 24 h ...
-
bioRxiv - Neuroscience 2020Quote: ... and goat anti-rabbit Alexa 647 (Invitrogen, Waltham, MA; for N = 3 birds). After 3 more washes in 0.1 % PBT ...
-
bioRxiv - Pathology 2022Quote: ... VSMCs (n = 3) were lysed using Pierce immunoprecipitation lysis buffer (Thermo Scientific, 87788) supplemented with protease inhibitor ...
-
bioRxiv - Systems Biology 2021Quote: ... coli phosphate-binding protein labeled with 7-Diethylamino-3-[N-(2-maleimidoethyl)carbamoyl]coumarin (MDCC) (phosphate sensor, CAT # PV4406, Thermo Fisher) upon binding of the free phosphate GTP hydrolysis product (excitation at 425 nm ...
-
bioRxiv - Neuroscience 2020Quote: ... An anterograde tracer of 5% biotinylated dextran amine (BDA; Invitrogen) was used in some cases ...
-
bioRxiv - Bioengineering 2023Quote: ... The concentrated virus was diluted 1:5 in hepatocyte medium containing N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid buffer (HEPES; 20 mM; Gibco) and 4 μm/mL polybrene (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was extracted and quantified from WwoxWT/WT and WwoxP47T/P47T n=6 mice/group (3 males and 3 females) and cDNA was synthesized using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... oligonucleotide duplexes were designed against TG2 (sense, 5’-AAGGGCGAACCACCTGAACAA-3’ and antisense, 5’-TTGTTCAGGTGGTTCGCCCTT-3’) and TOPOIIα siRNA (purchased from Thermo Fisher, Catalog # AM16708). Plasmids and miRNA were transfected with Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Immunology 2022Quote: ... The 3’-end of each probe was modified with an amine group and coupled to either tetramethylrhodamine (TMR; Thermo Fisher Scientific), Texas Red-X (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2024Quote: Fluorescent labelling of Tau and 14-3-3ζ protein for microscopy assays was done using amine-reactive DyLight405 or DyLight488-NHS ester (Thermo Scientific) following the manufacturer instructions and the established protocol 34.
-
bioRxiv - Cell Biology 2019Quote: ... Slides were washed 3 × 10 min with PBS and nuclei stained with 1 µg/mL 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) in PBS for 15 min ...
-
bioRxiv - Cancer Biology 2019Quote: 4T1 and 67NR cells at 70-80% confluence were transfected with the shRNA constructs described above in FuGene 6 at a ratio of 3:2 per manufacturer’s instructions (Thermo Fisher). Pools of transfected cells were selected in media with 7 µg/ml puromycin ...
-
bioRxiv - Biochemistry 2021Quote: ... 1-O-(6-BODIPY®558/568-aminohexyl)-2-BODIPY®FL C5-sn-glycero-3-phosphocholine (Thermo Fisher Scientific) as described previously [38] ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 ng/mL TPO and 40 ng/mL IL-3 from day 1 to day 6 with a media refresh every 2 days (all cytokines from Thermofisher). On day 8 ...
-
bioRxiv - Molecular Biology 2022Quote: Northern blots were performed as previously described with infrared probe and EDC (N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide) (Thermo Scientific) crosslinking43 ...
-
bioRxiv - Biochemistry 2023Quote: ... and Glycerol-3-Phosphate (cat. N° 20729) were from Cayman. Schneideŕs Drosophila medium (cat. N° 21720024) was from Gibco. ADP ...
-
bioRxiv - Microbiology 2021Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g.