Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 6 Chloro N 5 ethoxy 1H pyrazol 3 yl 3 nitropyridin 2 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... mcherry: 5’-ATGGTGAGCAAGGGCGAGGAG-3’ and 5’-CTTACTTGTACAGCTCGTCCATG-3’) from pKHR8-foxc1aKI and separately subcloned into pJET2.1 (ThermoFisher) to give pJET-mVenus and -mCherry ...
-
bioRxiv - Neuroscience 2024Quote: ... The siRNA sequence for YTHDF2 is 5′-AAGGACGTTCCCAATAGCCAA-3′ and for HIF1α is 5’-GCTGATTTGTGAACCCAT-3’ (Ambion). After 48 h from the initial transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 uM FluoZin-3 AM (Invitrogen) was add to dishes to stain cells for 1 hour and then was washed twice with PBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-GAAGUCACAACAGAGUGCAGGCAAA-3’) and an appropriate control (Cat. N° 12935300 - Invitrogen) using Lipofectamine RNAiMAX reagent (Invitrogen ...
-
bioRxiv - Neuroscience 2019Quote: ... Neurons were transfected with the CofActor optogenetic system (6 µg plasmid/plate) on day in vitro 3-5 (DIV3-5) using Lipofectamine 2000 (Invitrogen). 48 hours post transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... Nucleus staining was performed using 4’,6-diamidino-2-phenylindole (DAPI) (3 mM, D3571, Molecular Probes). Cells were counted from four randomly selected fields per culture under a confocal microscope (TCS SP8 ...
-
bioRxiv - Physiology 2021Quote: 2-3 viable human slices were incubated with Fluo4-AM (6 μM, Invitrogen cat. No. F1221) for 1h in 3 mM HEPES buffer (125 mmol/l NaCl ...
-
bioRxiv - Cell Biology 2019Quote: ... FM™ 4-64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) was purchased from Invitrogen. Rapamycin was purchased from LC Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... Streptomyces hyphae were incubated with 0.5 mg/ml FM 4-64 Dye (N-(3-Triethylammoniumpropyl)24-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Molecular Probes) for 15 min in the dark ...
-
bioRxiv - Neuroscience 2023Quote: Cultured neurons were incubated for 1 min with fluorescent dye N-(3-triethylammonium-propyl)-4-(6-(4-diethylamino)phenyl)-hexatrienyl)pyridinium dibromide (FM4-64; 4 µM; Invitrogen) and loaded by stimulation (10 Hz ...
-
bioRxiv - Neuroscience 2021Quote: ... DiIC18(3) dye (6 mg; Invitrogen, Carlsbad, CA, USA) was dissolved in 99.5% methylene chloride (300 μL ...
-
bioRxiv - Bioengineering 2022Quote: ... Amine-polystyrene microbeads (2 μm; Life Technologies) were coated with poly-L-lysine (PLL ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT, #I00671G, Fisher Scientific).
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Biochemistry 2020Quote: ... 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and N-hydroxysulfosuccinimide (Sulfo-NHS) were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cultures were plated on LB agar plates containing 60 μg/mL 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-gal; Thermo Fisher Scientific catalogue no. R0402). Antibiotics in media for bacterial growth were used at the following working concentrations ...
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C (for P. miniata) or 20C (for P. regularis) in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 micromols sodium sulfo-NHS and 5 micromols 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (Thermo Fisher #22980) in 10 μL of DMSO ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The pbf1 gene of johansen Standard was amplified with the primer pair psbNRO_F 5’-AGCATTGGGAGGCTCATTAC-3’ and psbNRO_R 5’-GGAAACAGCAACCCTAGTCG-3’ and cloned into to pCRTM2.1-TOPO® (Invitrogen). The vector was linearized with HindIII and in vitro transcription was performed according to the suppliers’ protocol ...
-
bioRxiv - Microbiology 2020Quote: ... RdRp_rev 5’-CAAATGTTAAAAACACTATTAGCATA-3’ RdRp_probe 5’-FAM-CAGGTGGAACCTCATCAGGAGATGC-TAMRA-3’) and/or TaqMan gene expression assays (Applied Biosystems) for ACTB (Hs99999903_m1) ...
-
bioRxiv - Immunology 2022Quote: ... and their corresponding FAM-labelled MGB probes (εGLT: 5′-AGGCACCAAATG-3′ and γ1GLT: 5 ′-CTCAGCCAGGACCAAG-3′) (Applied Biosystems) were designed in house ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’- CCACCCTCCAGCCAATC-3’ and FAM/ZEN-labeled probe 5’-ACAGGGCAACCATTGGCTCG-3’ with Taqman Gene Expression Master Mix (ThermoFisher).
-
bioRxiv - Microbiology 2023Quote: The embB region containing codon 406 was amplified using PCR primers F1 5’-TGATATTCGGCTTCCTGCTC-3’ and R1 5’-TGCACACCCAGTGTGAATG-3’ designed using Primer3 (23) (version 0.4.0) and acquired from ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA targeting topoisomerase 2beta (5’CGAUUAAGUUAUUACGGUUtt 3’, s106; 5’ GAGUGUACACUGAUAUUAAtt 3’, s108; both purchased at Ambion/ThermoFIsher Scientific), TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA targeting topoisomerase 2beta (5’CGAUUAAGUUAUUACGGUUtt 3’, s106; 5’ GAGUGUACACUGAUAUUAAtt 3’, s108; both purchased at Ambion/ThermoFIsher Scientific), TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’ ...
-
bioRxiv - Microbiology 2021Quote: ... Reverse 5’-CGA AGG TGT GAC TTC CATG-3’) on a QuantStudio 6 Flex thermocycler (Applied Biosystems). A standard curve was established in parallel using purified SARS-CoV-2 viral RNA.
-
bioRxiv - Cancer Biology 2021Quote: ... 5 mL N-2 Supplement (Thermo Fisher 17502048). Long-Term Glioma Organoid Medium and Short-Term Glioma Organoid Medium stocks were used up to 2 months and 1 week after preparation ...
-
bioRxiv - Cancer Biology 2021Quote: Relative cell proliferation rates were assayed using an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay kit (Vybrant™ MTT Cell Proliferation Assay Kit, Invitrogen™, Thermo Fisher Scientific, cat. no. V13154). Cells were plated in triplicate in a 96-well plate (5,000 cell/well) ...
-
bioRxiv - Cancer Biology 2021Quote: Relative cell proliferation rates were determined using an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay kit (Vybrant™ MTT Cell Proliferation Assay Kit, Invitrogen™, Thermo Fisher Scientific, cat. no. V13154). Cells were plated in triplicate in a 96-well plate (3,000 cell/well in 200 μL of complete medium and cultured under standard conditions for 48 h ...
-
bioRxiv - Cell Biology 2019Quote: RNF168 si #1: 5’- GGCGAAGAGCGAUGGAGGATT-3’ (Ambion)
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP7 siRNA: 5’-GCAACACUUAGAAGGAGAAGGCCUA-3’ (1362318, Invitrogen); GTPBP8 siRNA#1 ...
-
bioRxiv - Cell Biology 2023Quote: DCAF5 5‘-GCAGAAACCUCUACAAGAAdTdT-3’ (Ambion, silencer select)
-
bioRxiv - Bioengineering 2021Quote: ... The 5(6)-Carboxyfluorescein N-hydroxysuccinimide was purchased from Thermo Fisher Scientific (ON ...
-
bioRxiv - Cell Biology 2019Quote: The staining of limiting membrane of the yeast vacuole was achieved with FM™ 4-64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Invitrogen). Cells were grown to early-log phase in appropriate medium ...
-
bioRxiv - Cell Biology 2024Quote: ... hansenii cells were concentrated 10x in 200 μL YPD containing 40 μM FM4-64 dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) dye (Invitrogen™) to label endosomes for 8 minutes ...
-
bioRxiv - Neuroscience 2024Quote: Determination of sIL-6R was performed in the FN of NL and 21 dpi of aged WT and GFAP-IL6Tg (n=3-6/experimental group) using a precoated mouse ELISA kit (EMIL6RA, Fisher Scientific) and following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 cells (Shanbhag et al., 2010) were cultured in McCoy’s 5A (Modified) Medium (Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2023Quote: ... DAPI (4’,6-Diamidino-2-henylindole, dihydrochloride) was obtained from Invitrogen (Catalog: D1306, CAS:28718-90-3).
-
bioRxiv - Biophysics 2023Quote: ... 3-(N-morpholino)propanesulfonic acid) (MOPS) was purchased from Acros Organics. Texas Red DHPE (TR-DHPE) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Microbiology 2019Quote: ... Amplification of cyp51A was performed using the L98HR primer (5’-TTCGGTGAATCGCGCAGATAGTCC-3’) and TR34R primer (5’-AGCAAGGGAGAAGGAAAGAAGCACT-3’) (Invitrogen) at 100 nM ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Plant Biology 2022Quote: ... with and without the addition of 3-Amino-1H-1,2,4-triazole (Acros Organics (Thermo Fisher Scientific)) to test the strength of the interaction.
-
bioRxiv - Plant Biology 2022Quote: ... with and without the addition of 3-Amino-1H-1,2,4-triazole (Acros Organics (Thermo Fisher Scientific)) to test the strength of the interaction.
-
bioRxiv - Cancer Biology 2020Quote: ... Proton transport was measured using ATP-dependent quenching of 9-amino-6-chloro-2-methoxy-acridine (Acridine Orange, ThermoFisher) fluorescence quenching for isolated vacuoles as previously described21