Labshake search
Citations for Thermo Fisher :
3901 - 3950 of 10000+ citations for 6 IODO BENZO D 1 3 OXAZIN 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: One microgram of total RNA extracted using the Trizol reagent (Invitrogen) was used for oligo(dT)18-primed cDNA synthesis according to the reverse transcription protocol (TaKaRa) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Nucleic acids concentrations were determined with a Nanodrop One (Thermo Scientific), and 50 ng of product was used to prepare TGIRT-seq libraries for high-throughput sequencing.
-
bioRxiv - Microbiology 2022Quote: ... using a SuperScript III One-Step RT-PCR Kit (Invitrogen, Germany). Reverse transcription of the viral RNA and amplification of the cDNA was conducted in a LightCycler 480 System (Roche ...
-
bioRxiv - Plant Biology 2022Quote: ... One µg aliquots of RNA were digested with DNaseI (Thermo Scientific), and reverse transcribed by using RevertAid reverse transcriptase (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA quality and concentration were assessed using a Nanodrop One (ThermoFisher). Reverse transcription was performed with the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was quantified using NanoDrop One (Thermo Fisher Scientific, Madison, USA). The selective amplification of 16S rDNA gene was performed using bacterial universal primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... Concentrations of shRNA was measured with a NanoDrop One (Thermo fisher).
-
bioRxiv - Bioengineering 2022Quote: ... one droplet of NucBlue™ Hoechst 33342 (R37605, Thermo Fisher Scientific) was added per scaffold to visualize all cell nuclei and samples were incubated at 37 °C for 20 min ...
-
bioRxiv - Neuroscience 2022Quote: ... We used the Taqman one-step qRT-PCR (Invitrogen 11732-020) in a final volume of 12.5 μL per reaction in 384-wells PCR plates using a thermocycler (QuantStudio 6 Flex ...
-
bioRxiv - Cell Biology 2022Quote: ... Gene expression was quantified using One-Step qRT-PCR Kits (Invitrogen) in the Applied Biosystems Step One Plus Real-Time PCR System ...
-
bioRxiv - Plant Biology 2024Quote: BL21 Star™ (DE3) One Shot® (Invitrogen, Thermo Fisher Scientific) cells were transformed with the different vectors listed in Table 2 according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2024Quote: BL21 Star™ (DE3) One Shot® (Invitrogen, Thermo Fisher Scientific) cells were transformed with the different vectors listed in Table 2 according to the manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and the Step One Plus Real-Time PCR System (Applied Biosystems). Relative quantification was achieved by normalizing to the expression levels of Beta-2-Microglobulin (B2m ...
-
bioRxiv - Microbiology 2024Quote: ... DNA concentration was measured with Nanodrop One/OneC spectrophotometer (Thermo Fisher). Genomic DNA extracted from the cells were sent to SeqCenter ...
-
bioRxiv - Plant Biology 2024Quote: ... BL21 Star™ (DE3) One Shot® (Invitrogen, Thermo Fisher Scientific) cells were transformed with the respective vectors and the transformed cells were used to inoculate 200 mL LB medium containing 50 mg/ml kanamycin and 0.025 % glucose ...
-
bioRxiv - Plant Biology 2024Quote: ... BL21 Star™ (DE3) One Shot® (Invitrogen, Thermo Fisher Scientific) cells were transformed with the respective vectors and the transformed cells were used to inoculate 200 mL LB medium containing 50 mg/ml kanamycin and 0.025 % glucose ...
-
bioRxiv - Immunology 2024Quote: ... SuperScript™ III One-Step RT-PCR (ThermoFisher Scientific, Waltham, MA) was used according to the manufacturer’s instruction to amplify Mu Mx1 RNA using Mu Mx1 specific primers ...
-
bioRxiv - Immunology 2024Quote: ... RNA concentrations were determined using a Nanodrop one instrument (Thermofisher Scientific).
-
bioRxiv - Molecular Biology 2024Quote: ... and cultured (one fluke per two mL) in RPMI medium (Gibco) supplemented with 0.1% glucose ...
-
bioRxiv - Molecular Biology 2023Quote: ... in the Step One plus Real-time PCR system (Applied Biosystems).
-
bioRxiv - Microbiology 2024Quote: ... in qPCR Step-One Plus detection system (Applied Biosystems, Waltham, MA) using comparative CT method with endogenous control gyrase A used to normalize the expression variance of target genes among samples using the 2−ΔΔCT formula (33).
-
Assessment of salivary microRNA by RT-qPCR: Challenges in data interpretation for clinical diagnosisbioRxiv - Molecular Biology 2024Quote: Total concentration was quantified by Nanodrop One (Thermo Scientific, Wilmington USA), Qubit™ microRNA Assay Kits (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... on a Step One Plus Real-Time PCR system (Applied Biosystems). The primer and probe sequences were ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total RNA extractions were quantified with a Nanodrop One (Thermo Fisher), and RNA integrity was assessed with the Bioanalyzer 2100 RNA Nano assay (Agilent) ...
-
bioRxiv - Cancer Biology 2024Quote: ... qRT-PCR was performed with the Step One Plus (Applied Biosystems, Carlsbad ...
-
bioRxiv - Biochemistry 2024Quote: ... the absorbance determined at 280 nm (NanoDrop™ One, Thermo Scientific), and concentrations calculated using extinction coefficients taken from ProtParam.
-
bioRxiv - Biochemistry 2024Quote: ... Protein concentrations were measured on a Nanodrop One instrument (Thermo Scientific). 30 µg of each sample were mixed with 0.2 V of 6x sample buffer (350 mM Tris-Cl pH 6.8 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Quantification of RNA concentration was performed using NanoDrop One (Thermo Scientific). cDNA from 300ng of each sample’s RNA was synthesized using qScript cDNA Synthesis Kit ...
-
bioRxiv - Plant Biology 2023Quote: ... using the Step One Plus RT-PCR detection system (Applied Biosystems) and SYBR Green PCR Master Mix (Yeasen) ...
-
bioRxiv - Bioengineering 2024Quote: ... then adding one quarter culture volume of 0.05% trypsin/EDTA (Gibco) to the flask for 4 min at 37 °C ...
-
bioRxiv - Immunology 2023Quote: ... one was labeled with a Zenon IgG labeling kit (ThermoFisher Scientific) using AlexaFluor fluorochromes ...
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA was quantified using the NanoDrop One (Thermo Scientific, USA) and Agilent Tape Station ...
-
bioRxiv - Physiology 2023Quote: ... One-to-two drops of SlowFade Diamond Antifade Mountant (Invitrogen S36963) were added ...
-
bioRxiv - Neuroscience 2023Quote: In vivo samples: One ml of cold TRIzolTM Reagent (Invitrogen, #15596026) was added to each tissue sample and homogenized using a TIssueLyzer II (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... Eluted DNA was quantified on the NanoDrop One (Thermo Fisher Scientific) and diluted to the same concentration ...
-
bioRxiv - Developmental Biology 2023Quote: ... on a Step One Plus Real-Time PCR machine (Applied Biosystems). The following program was used ...
-
bioRxiv - Biochemistry 2023Quote: ... Concentration of all plasmids was measured by NanoDrop One (Thermo Scientific) and the plasmids were stored at −80°C.
-
bioRxiv - Biochemistry 2023Quote: ... purified RNA was quantified using a NanoDrop One spectrophotometer (Thermo Fisher). 500 ng of total RNA were reverse-transcribed using M-MLV reverse transcriptase (Invitrogen ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA concentration was measured using a NanoDrop One (Thermo Fisher Scientific). A minimum threshold of 10 ng/μL was required to proceed with reverse transcription ...
-
bioRxiv - Cell Biology 2023Quote: ... and RNA concentration was quantified using a NanoDrop One (Thermo Scientific). Equal amounts of RNA were treated with RQ1 DNase (M610A ...
-
bioRxiv - Genomics 2022Quote: ... RNA concentrations were measured using a NanoDrop One spectrophotometer (ThermoFisher Scientific). 1 μg of RNA was used to synthesize cDNA with First Strand cDNA Synthesis kit (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... one mini tablet of protease and phosphatase Inhibitor (# A32959, Thermo Fisher) was added to 10 ml of ice-cold N-PER Neuronal Protein Extraction Reagent (# 87792 ...
-
bioRxiv - Immunology 2023Quote: ... and a Superscript III Platinum One-Step qRT-PCR System (ThermoFisher). Primers and reporter probe bind to the LTR and their sequences are GCTAGACTCTCACCAGCACTTG (forward) ...
-
bioRxiv - Cancer Biology 2023Quote: ... All siRNAs but the ones against MdmX were purchased from Ambion and transfection was done using Lipofectamine RNAiMax transfection reagent (cat.#13778150 ...
-
bioRxiv - Immunology 2022Quote: ... clear-bottom 96-well plates (Thermo Fisher or Greiner Bio-One) at a density of 20,000 cells per well one day before the assay (day 0) ...
-
bioRxiv - Cell Biology 2023Quote: ... using a Step One Plus Real-Time PCR System (Applied Biosystems) and the following TaqMan primer sets ...
-
bioRxiv - Microbiology 2023Quote: ... coli DH5α or One Shot® ccdB SurvivalTM 2 T1R (Invitrogen) for plasmids containing the ccdB containing Gateway cassette were used.
-
bioRxiv - Evolutionary Biology 2023Quote: ... These constructs were transformed into One Shot Top10 competent cells (Invitrogen) following manufacturer’s instructions (see Supplemental Table S2 for primer sequences ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... One millimolar tryptamine and AP-enzyme (ThermoFisher IVGN2208; [40 U/mL]) stock solutions were prepared in AP-buffer (100 mM NaCl ...
-
bioRxiv - Biochemistry 2023Quote: ... coli strain was BL21(DE3) from Invitrogen (One ShotTM BL21(DE3), Cat ...