Labshake search
Citations for Thermo Fisher :
3701 - 3750 of 10000+ citations for rno mir 542 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time PCR was subsequently performed with cDNA using a universal PCR Master Mix (Thermo Fisher Scientific). The data were collected and analyzed using a StepOne Real-Time PCR System and StepOne Software v2.3 (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2020Quote: ... The qRT-PCR was performed using a StepOne Plus Real-Time PCR Thermo-cycler (Fisher Scientific, Canada), with an initial GoTaq® Hot Start Polymerase activation step at 95 °C for 2 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... and subjected to quantitative real-time PCR with the Power SYBR Green PCR Master Mix (Thermo Scientific) on StepOnePlus Real-Time PCR System (Thermo Scientific) ...
-
Cryptococcus neoformans secretes small molecules that inhibit IL-1β inflammasome-dependent secretionbioRxiv - Immunology 2019Quote: ... qRT-PCR was performed using SyBr Green Master Mix and StepOne real-time PCR system (Applied Biosystems). The primer sequences were as follows ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... A quantitative PCR was performed on a PikoReal 96 Real-Time PCR machine (Thermo Fisher Scientific TCR0096) using 0.2 % of the unamplified library and the following thermal profile ...
-
bioRxiv - Cell Biology 2020Quote: ... and 7900HT Fast Real-Time PCR System (Applied Biosystem) using SYBR Green PCR Master Mix (Life Technologies) and gene-specific primers ...
-
bioRxiv - Biochemistry 2021Quote: ... Quantitative PCR was performed according to manufacturer’s specifications on a StepOnePlus Real-Time PCR System (Thermo Fisher) using PerfeCTa® SYBR® Green SuperMix (Quantabio ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cDNAs were subjected to quantitative real-time PCR using SYBR Green PCR master mix (Applied Biosystems) and ViiA 7 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Genetics 2021Quote: ... and Real-time PCR reactions were performed using the Power SYBR Green PCR Master Mix (Applied Biosystems) on the 7900HT Fast Real Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real-time PCR (qRT-PCR) was carried out using SYBR green master mix (Applied Biosystems™) in a StepOne Plus thermal cycler (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative reverse transcription gene amplifications (qRT-PCR) were performed with StepOnePlus Real-Time PCR System (Applied Biosystems) using the Power SYBR Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Immunology 2021Quote: ... ChIP-DNA underwent qRT-PCR using a TaqMan® 7900HT Fast Real-Time PCR System (Applied Biosystems) per manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: ... and quantitatively detected by real-time PCR using the TaqMan® Universal PCR Master Mix (Life Technologies) with primers (forward primer - 5’ CCCATGTTTTCAGCATTATCAGAA 3’ and reverse primer-5’ CCACTGTGTTTAGCATGGTGTTTAA 3’ ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative PCR (qPCR) analysis was performed using an Applied Biosystems 7500 Fast Real-Time PCR system (ThermoFisher) and Brilliant II SYBR Green Master Mix (600830 ...
-
bioRxiv - Immunology 2021Quote: ... All qRT-PCR assays were performed on QuantStudio™ 3 Real-Time PCR System (Thermo Fisher®).
-
bioRxiv - Developmental Biology 2022Quote: Quantitative PCR (qPCR) analysis was carried out on a StepOnePlus™ Real-Time PCR System (Life Technologies) using Power SYBR® Green PCR Master Mix (Promega #A6002) ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative PCR (qPCR) analysis was conducted using a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). A ...
-
bioRxiv - Bioengineering 2022Quote: ... Quantitative real-time PCR (qPCR) was then performed using SYBR Green PCR Master Mix (#4309155; Thermo Fisher) with the LightCycler® 480 device (Roche) ...
-
bioRxiv - Bioengineering 2022Quote: ... Real-time quantitative PCR (qPCR) was performed using the SYBR Green PCR Master Mix (Applied Biosystems, 4309155). Primer sequences ...
-
bioRxiv - Biochemistry 2022Quote: ... Quantitative real-time PCR was performed using Power SYBR® Green PCR Master Mix (Applied Biosystems, 4368577) and PCRs were performed in a QuantStudio 5 cycler (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2022Quote: Quantitative PCR (qPCR) analysis was carried out on a StepOnePlus™ Real-Time PCR System (Life Technologies) using Fast SYBR™ Green Master Mix (ThermoFisher Scientific #4385612) ...
-
bioRxiv - Neuroscience 2024Quote: ... Quantitative real-time PCR (qRT-PCR) was carried out using ViiA (Applied Biosystems, Foster City, CA, USA). Reactions were run in triplicate and expression of each gene were normalized to the geometric mean of GAPDH as a housekeeping gene and analyzed by using the ΔΔCT method ...
-
bioRxiv - Microbiology 2024Quote: Reverse transcription quantitative PCR analysis was performed on QuantStudio 5 Real-Time PCR system (Thermo Scientific, USA) using the primer set from E or RdRp Charité (IDT Coralville ...
-
bioRxiv - Neuroscience 2024Quote: ... Quantitative PCR (qPCR) was performed using a QuantStudio™ 12K Flex Real-time PCR System (Applied Biosystems) and a QuantStudio™ 7K Flex Real-time PCR System (Applied Biosystems) ...
-
bioRxiv - Physiology 2024Quote: ... PCR and quantification were performed using a StepOnePlus Real-Time PCR System (Applied BioSystems, Waltham, Massachusetts, USA) with THUNDERBIRD SYBR qPCR Mix (Toyobo ...
-
bioRxiv - Cell Biology 2024Quote: ... Quantitative PCR was performed at the QuantStudio 6 Flex real-time PCR system (#4485691, Thermo Scientific, US) to determine the transcript expression of target genes using the respective primer pair and SYBR green master mix (#A25741 ...
-
bioRxiv - Immunology 2024Quote: ... Quantitative PCR was performed using a Step-One real-time PCR system (Applied Biosystems, Waltham, MA, USA) with THUNDERBIRD SYBR qPCR Mix (#QPS-201 ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR products were detected using an Applied Biosystems ViiA 7 Real-Time PCR System (ThermoFisher Scientific). Relative gene expression was determined by the 2-ΔΔCt method ...
-
bioRxiv - Cell Biology 2024Quote: ... All Quantitative PCR (qPCR) experiments were performed on the StepOnePlus fast-real-time PCR system (Applied Biosystems).
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification was performed using a Step One Plus real time PCR system (Applied Biosystems, Warrington, UK) with TOPrealTM qPCR 2X PreMIX (Enzynomics) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative Real-Time PCR (qRT-PCR) reaction was performed with TaqMan Gene Expression Assays (Applied Biosystems, USA), using gene-specific PLK4 and P-Cadherin (CDH3 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative real-time PCR (qRT-PCR) was carried out using PowerUp SYBR Green Master Mix (Applied Biosystems) in a StepOnePlus Real-Time PCR System ...
-
bioRxiv - Neuroscience 2023Quote: ... Quantitative PCR was performed in the QuantStudioTM 3 Real-Time PCR System (Applied Biosystems, Carlsbad, CA, USA) using the PowerUpTM SYBRTM Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2023Quote: ... The PCR amplification and analysis were performed on a QuantStudio 3 real-time PCR instrument (Applied Biosystems).
-
bioRxiv - Physiology 2023Quote: ... Quantitative PCR (qPCR) analysis was performed using a QuantStudio 7 Pro Real-time PCR System (Applied Biosystems), using PowerUP SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: Quantitative real-time PCR (qRT-PCR) was carried out using TaqMan mRNA expression assays (Thermo Fisher Scientific) and TaqMan 2× Mastermix Plus – Low ROX (Eurogentec ...
-
bioRxiv - Neuroscience 2023Quote: ... and qRT-PCR was performed on the QuantStudio 7 Flex Real-time PCR System (Thermo Fisher Scientific) with TB Green Premix Ex Taq Ⅱ (Takara Bio ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative PCR was performed using Power SYBR on the QuantStudio 7 Real-Time PCR System (ThermoFisher Scientific). mRNA expression levels were calculated relative to the housekeeping gene ...
-
bioRxiv - Developmental Biology 2022Quote: ... Quantitative real-time PCR was performed using Power SYBR Green PCR Master Mix (Cat. # 4367659, Applied Biosystems) using gene-specific primers on an ABI7500 Real-time PCR (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR reactions were performed using 10 µl cDNA in PikoReal 96 real-time PCR system (Thermo Scientific). Quantification data were analyzed by 2-tailed ...
-
bioRxiv - Immunology 2023Quote: ... and qRT-PCR was performed using the QuantStudio™ 5 Real-time PCR system (Thermo Fisher Scientific). The comparative method of relative quantification (2-ΔΔCt ...
-
bioRxiv - Genetics 2023Quote: ... We quantified expression using quantitative real-time PCR with SYBR™ Green PCR Master Mix (ThermoFisher Scientific), according to manufacturer specifications ...
-
bioRxiv - Plant Biology 2023Quote: ... qRT-PCR was conducted with an ABI PRISM 7300 Fast Real-Time PCR system (Applied Biosystems, USA) using a SYBR Green Ι Master mix kit (Takara) ...
-
bioRxiv - Bioengineering 2023Quote: ... Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using Taqman PCR Master Mix (Applied Biosystems) and samples were amplified on an ABI Prism 7900HT Fast Detection System (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA were generated using SuperScript® VILOTM cDNA Synthesis Kit (ThermoFisher Scientific).Real-time PCR reactions were carried out using Power SYBR® Green PCR Master Mix (ThermoFisher Scientific) and run on StepOne Real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Immunology 2023Quote: Quantitative PCRs (qPCR) were run and analyzed on a QuantStudio3 Real-Time PCR System (Thermo Fisher Scientific) according to the PowerUP SYBR Green (Thermo Fisher Scientific #25741 ...
-
bioRxiv - Neuroscience 2023Quote: ... All qRT-PCR reactions were performed in triplicate on a StepOnePlusTM Real- Time PCR System (Applied Biosystems) and relative expression calculated using the 2-ΔΔCT method with data normalized to GAPDH or SNORD48 (see Table XX for primer sequences).
-
bioRxiv - Cancer Biology 2024Quote: ... Quantitative PCR was performed in the QuantStudioTM 3 Real-Time PCR System (Applied Biosystems, Carlsbad, CA, USA) using the PowerUpTM SYBRTM Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2024Quote: ... Quantitative real time PCR (qRT-PCR) was done using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) along with custom designed ...
-
Candida albicans enhance Staphylococcus aureus virulence by progressive generation of new phenotypesbioRxiv - Microbiology 2024Quote: Quantitative real-time PCR (qRT-PCR) was performed with the PowerUp SYBR Green Master Mix (Applied Biosystems) in a StepOnePlus™ Real-Time PCR System (Applied Biosystems ...