Labshake search
Citations for Thermo Fisher :
3701 - 3750 of 10000+ citations for Recombinant Human ITGAL & ITGB2 Protein His Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... The plate was coated with 2 µg/mL mouse anti-His antibody (Invitrogen cat. #MA1-21315-1MG, ThermoFisher Scientific) overnight at 4°C ...
-
bioRxiv - Plant Biology 2022Quote: ... fused with an N-terminal 6×His-tag and cloned into expression vector pPIC9 (Thermo Fisher Scientific, California, USA). Correctness of the resulting constructs was confirmed by DNA sequencing prior to introduction into Pichia pastoris strain GS115 (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... the membranes were incubated 1 mg L-1 of anti-6X-His tag monoclonal antibody [HIS.H8] with an HRP conjugate (ThermoFisher) suspended in 10 mL 1X TBST for 0.5 hours ...
-
bioRxiv - Systems Biology 2022Quote: HeLa cells and FUCCI -HeLa cells were cultured in DMEM medium (Hi Media, AT007) supplemented with 10% FBS (Gibco) and 1% Penicillin-Streptomycin (Hi Media, ...
-
bioRxiv - Molecular Biology 2019Quote: ... The lysate including his-FAP-interacting peptides were collected and submit to a MS facility (Thermo Fisher, Inc.; USA) for analysis ...
-
bioRxiv - Biochemistry 2020Quote: pcDNA4-V5-NAA80-M23L was constructed by subcloning NAA80 from pcDNA3.1-NAA80-V525 into the TOPO TA vector pcDNA 4/Xpress-His (Invitrogen). Then the M23L mutation was introduced and the N-terminal Xpress tag was replaced with a V5 tag ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 228-10481) cDNA was cloned into the BamHI-NotI of the pcDNA3.1(+)-myc-His expression vector (Invitrogen, CAT# V80020) yielding pcDNA3.1-BRCA2T (BRCA2/2662T) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The first round PCR reaction was performed by adding 1 µl of cDNA template to a 20 µl reaction containing 0.005 U of Platinum Taq Hi-Fidelity polymerase (Invitrogen) as previously described (59) ...
-
bioRxiv - Microbiology 2020Quote: ... An aliquot of 50 ng of purified HIV-1 env DNA was used to clone into the pcDNA 3.1D/V5-His-TOPO vector (Invitrogen) and MAX Efficiency Stlb2 competent cells (Life Technology ...
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...
-
bioRxiv - Cell Biology 2019Quote: ... Templates were prepared on the Ion Chef system using an Ion PI Hi-Q Chef kit (Thermo Fisher Scientific) and sequencing was performed on an Ion Proton system using with Ion PI Hi-Q sequencing kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... hLIGHT (L83-V240) and mHVEM (Q39-T142) were separately cloned into the pMT/BiP/V5-His A vector (Invitrogen) and co-transfected into Drosophila S2 cells with the pCoBlast (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... were coated at room temperature for 3 hours with 1 μg/mL PolyRab anti-His antibody (ThermoFisher, PA1-983B), followed by overnight blocking with blocking buffer containing 1x PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... which were then separated using SDS-PAGE and visualized using Wester blotting with an anti-his tag antibody (Invitrogen).
-
bioRxiv - Biochemistry 2021Quote: ... which were then separated using SDS-PAGE and visualized using Wester blotting with an anti-his tag antibody (Invitrogen).
-
bioRxiv - Immunology 2021Quote: ... FACS-sorted cells were suspended at 0.5×106 cells/mL in RPMI 1640 medium supplemented with 10% HI-FCS and 1% PenStrep (10378016; Gibco). CD14+HLA-DRneg/low/CD14+HLA-DRhigh monocytes were cultured in 96 well plates (200μL/well ...
-
bioRxiv - Immunology 2021Quote: ... Clonal amplification of the libraries was done using the Ion-PI-Hi-Q Sequencing 200 Kit (Thermo Scientific, USA) PCR emulsions ...
-
bioRxiv - Neuroscience 2023Quote: The plasmid for heterologous expression of fshr-1 in HEK cells was obtained by directionally cloning the fshr-1 cDNA into the pcDNA3.1/V5-His-TOPO vector (Invitrogen). The cDNA sequence of the fshr-1a gene isoform was amplified by PCR using cDNA from mix-staged wild-type C ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant AtGNL-6XHIS was detected using an anti-HIS (C-term)/AP antibody at a 1:2,000 v/v dilution (Invitrogen) and CDP-start ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were then incubated for 1 h at room temperature with the following primary antibodies: mouse anti-His-Tag (dilution 1:1,000, clone HIS.H8, Invitrogen MA121315), mouse anti-Flag (dilution 1:1000 ...
-
bioRxiv - Genetics 2024Quote: ... and 15 µL of each eluate was mixed with the same volume of Hi-Di formamide (Thermo Fisher Scientific). Samples were finally sequenced either in one or in both directions on a 3500 Genetic Analyzer device (Applied Biosystems/Hitachi ...
-
bioRxiv - Neuroscience 2024Quote: ... The coding sequences of a five glycine linker and intracellular GFP and biotin tags followed and were inserted in a pcDNA3.1(-)/myc-His (Invitrogen) vector backbone ...
-
bioRxiv - Genetics 2023Quote: ... standard fragment analysis conditions) with 0.8 ul PCR product is loaded in 9.4 ul Hi-Di Formamide (Applied Biosystems), with 0.1 ul GeneScan 500 LIZ (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... and gB[H527P]-His EVs was performed at 300 keV on a Titan Krios electron microscope (Thermo Fisher scientific) equipped with a Gatan K3 (5 μm/pixel ...
-
bioRxiv - Biophysics 2023Quote: ... and from the 3’-terminus by the 10×His-tag nucleotide sequence and inserted into a pFastBac1 vector (Invitrogen) via the BamHI(5’ ...
-
A crucial role for dynamic expression of components encoding the negative arm of the circadian clockbioRxiv - Biochemistry 2023Quote: ... Sequencing was done using the Ion PI™ Hi-Q™ Sequencing 200 Kit (Thermo Fisher Scientific, Catalog # A26772) on Ion Proton sequencer with sequencing data processing using the Torrent Suite TM Software (Ver ...
-
bioRxiv - Biophysics 2023Quote: ... and from the 3’-terminus by 10×His-tag nucleotide sequence and inserted into the pFastBac1 vector (Invitrogen, USA) via the BamHI(5’ ...
-
bioRxiv - Developmental Biology 2022Quote: ... mCherry-Emp-V5His construct was cloned using Hifi DNA assembly kit (NEB E5520S into the pAc5.1/V5-His A vector (Invitrogen) using the following enzymes Acc65I and XhoI ...
-
bioRxiv - Immunology 2023Quote: HCMV US18 and US20 were amplified from the HCMV TB40/E BAC (accession #EF999921) and subcloned into pcDNA3.1-V5/His (Invitrogen) via the KpnI/NotI sites to generate pcDNA3.1 US18-V5/His and pcDNA3.1 US20-V5/His ...
-
bioRxiv - Molecular Biology 2023Quote: ... ceSMSγ and ceSMSr cDNAs were PCR amplified and ligated into the copper-inducible pMT/V5-His B vector (Invitrogen).
-
bioRxiv - Biophysics 2024Quote: ... The cDNA was eluted from Dynabeads using 11 μL Formamide-ROX mix (1000 μl Hi-Di Formamide (Thermo Fisher), 8 μl of 350 ROX size standard (Thermo Fisher) ...
-
bioRxiv - Immunology 2023Quote: ... Amplification and cloning of the truncated versions of TGM4 (D1-3 and D4-5) was performed by PCR amplification using proofreading Taq polymerase Phusion Hi as per the manufacturer’s instructions (Invitrogen), full-length codon-optimised TGM4 as template ...
-
bioRxiv - Microbiology 2023Quote: ... we initially digested the pNL4-3 plasmid with EcoRI and XhoI and subcloned this fragment into pcDNA3.1/myc-His A (Invitrogen). To generate pcDNA3.1 NL4-3 Env TMTR ...
-
bioRxiv - Genetics 2024Quote: ... together with internal size standard ladder where 0.8 µl PCR product was loaded in 9.4 µl Hi-Di Formamide (Applied Biosystems), with 0.1 µl GeneScan 500 LIZ (Applied Biosystems) ...
-
bioRxiv - Biochemistry 2024Quote: ... The membrane was incubated overnight at 4°C with anti-His-Tag antibodies (Thermo Fisher Scientific, USA, #MA1-21315) diluted 1:1000 in the blocking solution ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by a 6× His-tag was cloned into the BamHI and XbaI sites of the pcDNA 3.1 vector (#V79020, Invitrogen) containing the vascular endothelial growth factor receptor 1 (VEGFR ...
-
bioRxiv - Biochemistry 2022Quote: ... The antibody-protein complexes were isolated by incubation with magnetic beads (Invitrogen Dynabeads protein A and protein G) for 6 hours at 4℃ ...
-
bioRxiv - Physiology 2023Quote: ... supernatant protein concentration was determined by BCA protein assay (Pierce BCA Protein Assay Kit, Cat#23225, Thermo Scientific). Twenty μg/lane was run (200V ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatant containing nuclear proteins was measured for protein concentration using Pierce BCA Protein Assay Kit (Thermo Scientific) and stored at -80°C until use ...
-
bioRxiv - Bioengineering 2023Quote: ... Total protein concentration was determined using the Qubit™ Protein and Protein Broad Range (BR) Assay Kit (Invitrogen).
-
bioRxiv - Bioengineering 2023Quote: Protein yield: MSC-EV preparation total protein concentration was determined using the Micro BCA Protein Assay Kit (ThermoFisher) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... Protein concentration of each sample was determined using the BCA protein assay (Pierce™ BCA Protein Assay, Thermofisher). 40 micrograms of protein per lane were prepared in SDS sample buffer (50 mM Tris pH 6.8 ...
-
bioRxiv - Neuroscience 2024Quote: Protein concentration in the protein sample was determined by using a BCA protein assay kit (Pierce, Thermo Scientific). Samples in aliquots of 100 μL each were stored at -80°C.
-
bioRxiv - Microbiology 2020Quote: ... All PCR reactions were carried out using Recombinant Taq DNA Polymerase (5U/μl from Thermo Scientific) and standard PCR cycling conditions.
-
bioRxiv - Cell Biology 2022Quote: ... Purified recombinant plasmid DNA was digested with PacI and transfected into HEK293 cells with Lipofectamine (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Recombinant antibodies were transiently transfected and produced in vitro in 293F Freestyle suspension cells (Thermofisher Scientific). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... and recombinant expression was undertaken using the FreeStyle™ MAX 293 Expression System (Thermo Fisher Scientific) according to the manufacturer’s guidelines ...
-
bioRxiv - Biochemistry 2021Quote: ... the recombinant GST-SHP2 in supernatant was affinity-purified by Pierce glutathione agarose (Thermo Fisher Scientific) and eluted with lysis buffer containing 20 mM GSH ...
-
bioRxiv - Zoology 2021Quote: ... The recombinant plasmid was quantified using a NANO-DROP 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). The plasmid copy number was calculated using the equations described by Yun et ...
-
bioRxiv - Plant Biology 2020Quote: ... Semi-quantitative PCR was performed within the linear amplification phase using a recombinant Taq Polymerase (Invitrogen) amplifying a fragment of 323 base pairs (bps ...