Labshake search
Citations for Thermo Fisher :
3701 - 3750 of 10000+ citations for 8 Chloro 2 3 4 5 tetrahydropyrido 3 2 f 1 4 oxazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... 3.125 μM Oligo-dT 30 VN (IDT, 5’AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3.125 μM Oligo-dT 30 VN (IDT, 5′AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3′) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Developmental Biology 2022Quote: ... with cDNA (diluted 1:5) and gene-specific primers (Key Resources Table) on a QuantStudio 3 Real-Time PCR System (Applied Biosystems) in triplicate ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were washed in 0.3% Triton-X/PBS 3× 5 min and incubated with secondary antibody (goat anti-rabbit-Alexa Fluor 594: 1:800, Life Technologies) for one hour ...
-
bioRxiv - Evolutionary Biology 2021Quote: For ethanol preference assays, experimental substrates were 1% agarose and contained 75mM sucrose and increasing concentrations (3%, 5%, and 7%) of ethanol (ThermoFisher #BP2818); control substrates were 1% agarose and contained 75mM sucrose.
-
bioRxiv - Cell Biology 2021Quote: ... Slides were then washed 3 x 5 minutes with PBS and incubated with the Anti-guinea pig IgG Alexa Fluor 488 (1:200, Life Technologies) diluted in 10% FBS for 1 hour at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.1 μM 6-JOE-conjugated reverse primer (5’-6-JOE-GATGATCTCCACCTTGCCGT-3’) was extended with 1 pmol of RNA as template using Superscript III (Thermo Fisher) as reverse transcriptase ...
-
bioRxiv - Genetics 2023Quote: ... Ovaries were washed 3 times for 5 min with PBTx before incubation at room temperature in 1 μg/mL DAPI (Invitrogen, ThermoFisher Scientific) solution in PBS for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GAGACCCUAUCCGUGAUUAtt-3’ and antisense: 5’- UAAUCACGGAUAGGGUCUCtt-3’ (Silencer Select, rat negative control #1; scrambled siRNA and all siRNAs were from Ambion, Life Technologies). Transfection complexes were prepared in accordance with the instructions provided by the manufacturer and added to 2×105 cells seeded per well in 24-well plates.
-
bioRxiv - Cell Biology 2024Quote: ... mouse calvariae were dissected from 1–3 days old neonatal mice and digested sequentially 5 times for 25 minutes in α-MEM (Gibco) containing 0.1% collagenase (Roche ...
-
bioRxiv - Bioengineering 2024Quote: ... and incubated for 3-5 minutes at 37°C with a 1:10 dilution of trypsin 2.5% (Thermo Fisher #15090-046) in PBS (HSCs ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 ml was diluted 1:1 with PBS (Thermo Fisher Scientific, Waltham, MA) and kept on ice for purity analysis by flow cytometry ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR was performed on QuantStudio 3 and 5 Real-Time PCR Systems (Thermo Fisher Scientific) based on the following cycling parameters ...
-
bioRxiv - Systems Biology 2019Quote: ... 5’-ACG UGA CAC GUU CGG AGA Att-3’) by Lipofectamine 2000 (Thermo Fisher, #11668019) 48 hr before performing experiment.
-
bioRxiv - Cell Biology 2019Quote: ... CAP-D3 (5-CAUGGAUCUAUGGAGAGUATT-3)29 and control15 were transfected using Oligofectamine transfection reagent (Invitrogen) according to the manufacturer’s instructions and analysed 48h after transfection ...
-
bioRxiv - Genetics 2019Quote: ... 5’ -6FAM CTC AGA GAC ATA TCA AAG ATT CCA GGG-MGB-3’ (Life Technologies). Viral load is expressed on a Log10 scale as viral genome copies per milliliter (plasma samples ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 mM EDTA) and settled for 3 min in a magnetic stand (Fisher scientific, #FERMR02). Beads were then resuspended in 1 volume of IP buffer and ready to use ...
-
bioRxiv - Molecular Biology 2022Quote: ... Grids were blotted for 3 - 5 s in a Vitrobot (Mark IV, Thermo Fisher Scientific) at 20 °C and 100% humidity ...
-
bioRxiv - Cell Biology 2022Quote: Control siRNA against Luciferase (siLuc) was custom ordered from Life technologies (sense: 5’-uaugcaguugcucuccagcdtdt-3’). Individual or pooled siRNAs against other targets were ordered from Horizon Discovery (Dharmacon) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and MIT_v2.1_SbfInifJ_RV2 5’-AACCTGCAGGGCTAACTAACTAACCACGGACAAAAAACC-3’) and ligated into pCR Blunt II TOPO (Thermo Fisher Scientific). The second half containing nifBQFUSVWZM was amplified with SbfI sites on either end (with oligos MIT_v2.1_SbfInifB_FW 5’-AACCTGCAGGTACTCTAACCCCATCGGCCGTCTTA-3’ ...
-
bioRxiv - Developmental Biology 2019Quote: For live imaging 3-5 day old flies were dissected in Schneider’s Insect Media (Thermofisher) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Genetics 2021Quote: ... 3×105 U2OS cells were incubated with 5 pmol siRNA using lipofectamine RNAiMAX (Thermo Fisher) in a 12-well tissue culture plate for 2hr ...
-
bioRxiv - Genomics 2021Quote: ... Erythrocytes were lysed by treatment with 3-5 mL ACK lysing buffer (Gibco, Cat#A1049201) for 5 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... London) were transiently transfected with the following antisense oligos: ROD1 (5′ GGAAUGAUAUUGAGCUGCUAACAAA 3′; ThermoFisher Scientific), TACC3 (5’ GAGCGGACCUGUAAAACUA 3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... 3-5 mm skin biopsies were collected in Biopsy Collection Medium (RPMI 1460 [Thermo Fisher] with 1X Antibiotic-Antimycotic [Thermo Fisher]) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Add pre-mix chewing solution (5 μl 10xNEBbuffer2.1, 3 μl 100 mM DTT (ThermoFisher, A39255), 2 μl 100 mM ATP (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... homogenized and placed in sterile 5 mL Eppendorf tubes containing 3 mL of RNAlater (ThermoFisher). The tubes were stored at -20°C upon our arrival in the laboratory ...
-
bioRxiv - Bioengineering 2024Quote: ... Red blood cells were lysed with ACK Lysing Buffer (Gibco, 3 ml for 5 min). The cells were counted and resuspended in RPMI-1640 medium (Corning ...
-
bioRxiv - Cell Biology 2023Quote: ... digestion for 3 to 5 min at 37 °C and washed with Neurobasal medium (Invitrogen) supplemented with 2% B-27 (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... The neurons were then washed 3 times for 5 minutes with 1X DPBS (14080055, Gibco) containing 0.1% Tween ...
-
bioRxiv - Microbiology 2023Quote: ... FungiQuant-Prb (6FAM) 5′-TGGTGCATGGCCGTT-3′ (MGBNFQ) 57 and QuantStudio3 instrument (Applied Biosystems, CA, USA). We used the following qPCR conditions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and then 3 hours at 37°C with 5 μg/mL mouse laminin (Thermo Fisher). Neurons are cultured in BrainPhys neuronal medium (Stemcell Technologies ...
-
bioRxiv - Immunology 2023Quote: ... Fluorescence was measured using a QuantStudio 3 or QuantStudio 5 qPCR machine (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2023Quote: ... 5 × 106 cells were cultured in 3 ml Dulbecco’s modified Eagle’s medium (DMEM) (Life Technologies) supplemented with 10% fetal bovine serum (Life Technologies).
-
bioRxiv - Neuroscience 2024Quote: ... 3-5 μL of a heavy-weight dextran (Invitrogen, Cat#D1818, 70,000 MW, lysine fixable) was injected into each juvenile octopus and allowed to circulate throughout the body for 5 minutes ...
-
bioRxiv - Bioengineering 2024Quote: ... GAPDH reverse: 5′-AAG TGG TCG TTG AGG GCA ATG -3′ (Invitrogen, Thermo Fisher Scientific); ALIX forward ...
-
bioRxiv - Bioengineering 2024Quote: ... GAPDH reverse: 5′-AAG TGG TCG TTG AGG GCA ATG -3′ (Invitrogen, Thermo Fisher Scientific); ALIX forward ...
-
Tumor microenvironment acidosis favors pancreatic cancer stem cell properties and in vivo metastasisbioRxiv - Cancer Biology 2024Quote: ... and the cells resuspended in 3-5 mL of pancreatosphere medium (DMEM/F12 (Gibco, #11320033), 1% P/S ...
-
bioRxiv - Plant Biology 2024Quote: ... Cells were disrupted by passing them 3-5 times through a French press (Thermo Fisher) and centrifuged for 50,000g for one hour at 4°C ...
-
bioRxiv - Immunology 2024Quote: ... permeabilised with 0.5% Triton x-100 and OPP incorporation into newly synthesised peptides was measured by conjugating with Alexa647-azide via a Click-IT chemistry reaction (2 µM Alexa-647-azide, 2 mM CuSO4, 5 mM ascorbic acid in PBS) (Invitrogen) and assessing fluorescence by flow cytometry.
-
bioRxiv - Neuroscience 2024Quote: ... After 4 times 5-minute washes in PBS with 0.5 % Tween® 20 (Fisher Scientific #9005-64-5), each slide was again dried around tissue slices and PAP pen was re-applied ...
-
bioRxiv - Biophysics 2019Quote: ... Cells labeled for Syt-7 were then incubated for 60 minutes with polyclonal cross-adsorbed un-conjugated F(ab’)2-Goat anti-Rabbit IgG (Invitrogen, ThermoFisher, Cat. # A24539, 1:300) diluted in TBS-0.2% BSA solution to bind the possibly remaining free primary antibody sites (anti-Syt-7 ...
-
bioRxiv - Genetics 2020Quote: ... After washing and incubation with 1:2500 Alexa Fluor ® 568 F(ab’)2 fragment of goat anti-Rabbit IgG (H+L) (Thermo Scientific # A-21069) cells were stained with DAPI and mounted in VECTASHIELD (VectorLaboratories) ...
-
bioRxiv - Microbiology 2024Quote: ... 440-2 and 445-3 were generated using one of two methods 1) using a Mouse IgG1 Fab and F(ab′)2 Preparation Kit (Thermo Scientific™ Pierce™) which uses immobilized Ficin for cleavage 2 ...
-
bioRxiv - Bioengineering 2023Quote: B-RBD cells (1 × 107 cells/mL) were combined with 4 μM Fluo-4 AM (Invitrogen, USA, Cat: #F14217) for 20 min at 37°C ...
-
bioRxiv - Genetics 2019Quote: ... followed by Alexa Fluor 568 F (ab’)2 fragment of goat anti-mouse IgG secondary antibody (Invitrogen #A11019), was used for fluorescent labeling of enteric neurons as previously described (40 ...
-
bioRxiv - Biochemistry 2022Quote: ... and/or Alexa Fluor 594® F(ab’)2 fragment of goat anti-mouse IgG (H+L) (Invitrogen). Samples were then washed with PBS 1X+1% BSA and resuspended in 200 μl of the same buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... treated coverslips and incubated at 37°C for 2-6 hours in Dulbecco’s modified Eagle’s medium (F-12/DMEM; Invitrogen) supplemented with 1% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2020Quote: ... and F(ab’)2-Goat anti-Human IgG-Fc secondary antibody conjugated with R-phycoerythrin (ThermoFisher Catalog # H10104). Labeled cells were acquired using a Thermo-Fisher Attune NxT flow cytometer and analyzed using Flowjo Software.
-
bioRxiv - Immunology 2020Quote: ... Secondary F(ab′)2 fragment of goat anti-rabbit IgG (H+L) Alexa Fluor 647 (Thermo Fisher Scientific) was used to detect the pERM Abs ...