Labshake search
Citations for Thermo Fisher :
3601 - 3650 of 10000+ citations for TBARS MDA Universal Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... then lysed in hypertonic buffer B (10mM Tris-HCl pH 7.5, 800mM NaCl, protease and phosphatase inhibitors, and universal nuclease (ThermoFisher Scientific)) for 5 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... RNase was tested by incubation of 0.1 mg/mL RNase A with 1 µM of either universal mouse RNA (QS0640, ThermoFisher UK) or extracted S ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was loaded onto 96.96 Dynamic Arrays (Fluidigm, South San Francisco, CA) for qPCR amplification using Universal PCR Master Mix (Applied Biosystems) with a uniquely compiled Taqman assay primer set (Supplementary Table 1 ...
-
bioRxiv - Plant Biology 2021Quote: ... The 10 μL reaction mixture was prepared as follows: 5 μL TaqMan™ Fast Universal PCR Master Mix (Applied Biosystems), 0.2 μL each of forward and reverse primers (0.2 uM) ...
-
bioRxiv - Immunology 2020Quote: ... against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2021Quote: ... mixed with 0.5 μL 20X TaqMan Gene Expression Assays and 5 μL of 2X TaqMan Universal PCR Master Mix (Applied Biosystems) for a final volume of 10 μL ...
-
bioRxiv - Molecular Biology 2020Quote: ... Primer and probe concentrations were optimised according to suggestion in the manufacturer’s instructions (TaqMan Universal PCR mastermix, Applied Biosystems, USA).
-
bioRxiv - Microbiology 2021Quote: ... and viral cDNA was generated using the universal F(A) influenza primer (GTTACGCGCCAGCAAAAGCAGG) and the Maxima Reverse Transcriptase (Thermo Scientific). RNA Copy Number was quantitatively determined by Droplet Digital qPCR (Bio-Rad ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples of bilateral NTS obtained from LCM and lysed on cap were directed into universal reverse transcription reaction to reverse transcribe all mRNA (VILO, ThermoFisher). Following a universal reverse transcription ...
-
bioRxiv - Cancer Biology 2019Quote: ... and PCR was performed using the TaqMan® Universal Master Mix with UNG (Applied Biosystems, Life Technologies, Carlsbad, CA, USA), and the TaqMan microRNA assays (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2019Quote: ... and PCR was performed using the TaqMan® Universal Master Mix with UNG (Applied Biosystems, Life Technologies, Carlsbad, CA, USA), and the TaqMan microRNA assays (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2021Quote: ... All real-time polymerase chain reactions were run with Taq MAN Universal PCR Master Mix (Applied Biosystems, Foster City, CA) and with primers from Applied Biosystems on a 7900 HT Fast Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2019Quote: ... 140 µL of virome was treated with 2.5 units of Pierce™ Universal Nuclease (Cat. No. 88700, ThermoFisher Scientific, USA) for 3 min ...
-
bioRxiv - Physiology 2021Quote: ... Assays for mouse qPCR were designed using the Roche Universal Probe Library and primers were purchased from Invitrogen (ThermoFisher, UK). A standard curve prepared from pooled cDNA samples was processed with samples on a Lightcycler 480 system (Roche Diagnostics ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μL of TaqMan RNase P probe and 10 μL of 2X TaqMan Fast Universal PCR Master Mix (Applied Biosystems), were used in a final reaction volume of 20 μL performed in a StepOnePlus Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The supernatant was passed through a 22μm syringe driven filter (Millex) in a Biological Class II laminar airflow cabinet into a sterile universal container (Thermo scientific) and stored at 4 °C until required ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative reverse transcription polymerase chain reaction (RT-qPCR) analysis was performed using the TaqMan Universal PCR Master Mix (Applied Biosystems) and cDNA derived from 40ng total RNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... qRT-PCR was performed using 2x ChamQ Universal SYBR qPCR Master Mix (Vazyme, L/N TE342F9) with QuantStudio3 machine (Thermofisher). The cycle procedure was at 50.0°C for 2 min ...
-
bioRxiv - Immunology 2021Quote: ... Biomarker expression was determined using Taqman gene expression probes (Supplemental Table 1) and Universal master mix (ThermoFisher Scientific cat#4305719) with expression levels normalized to Gapdh.
-
bioRxiv - Genetics 2020Quote: ... Real-time quantitative PCR were performed on 1ml of RT reactions using TaqMan Universal Mastermix No AmpeErase UNG (Life Technologies) on a One Step Plus thermocycler (Thermo Fisher) ...
-
bioRxiv - Bioengineering 2022Quote: ... incubated with 1X phosphate-buffered saline (PBS) supplemented with 1 kU/mL of Pierce Universal Nuclease (Thermo Fisher Scientific, #88702) for 2 hours to remove cellular debris ...
-
bioRxiv - Cancer Biology 2022Quote: ... qRT-PCR was performed using Taqman universal PCR mix and predesigned gene expression assays with best coverage from Applied Biosystems. The following primer sets were used in our study:
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed with the synthesized cDNA using Taqman fast universal 2X PCR Master Mix (Thermo Fisher Scientific, 4352042) and Taqman probes (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... Extracted vRNA was reverse transcribed using a 1:1 ratio of universal influenza primers (53)(S2 Table) and Maxima RT (Thermofisher) per protocol instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Each sample was run in triplicate in 20 μl of reaction volume using TaqMan Universal PCR Master Mix according to the manufacturer’s instructions (Life Technologies) or SYBR green Master Mix according to the manufacturer’s instructions (Life Technologies) ...
-
bioRxiv - Immunology 2023Quote: siRNA for mouse Gpr109a (MSS234551), and control siRNA (Stealth RNAi Negative Universal Control, #12935) were purchased from Invitrogen (Carlsbad, CA). Ten microliters of 20 μM siRNA was introduced into BMMCs (5 × 106 ...
-
bioRxiv - Cell Biology 2023Quote: ... Real-time PCR was performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme) on the QuantStudio 6 Flex (Life Technologies). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... Quantitative PCR of early and late retrotranscribed products was done using the TaqMan Universal Master mix II no UNG (Ref 4440040, ThermoFisher) and the quantity normalized to PGBD loading control ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative real time PCR was then performed using the Taqman Universal PCR Master Mix (434437) following the manufacturer’s instructions in an ABI PRISM 7700 Thermocycler (Applied Biosystems).
-
bioRxiv - Immunology 2023Quote: ... Freshly thawed PBMCs and colon lymphocytes were thawed quickly at 37 °C and washed in CTL-Wash media (CTLW-010, Cellular Technology Limited) supplemented with 50 U/mL Pierce Universal Nuclease (88701, ThermoFisher). Lymphocytes ...
-
bioRxiv - Microbiology 2023Quote: ... lyophilized and resuspended in Procartaplex Universal Assay Buffer and stored at −80°C prior to measurement of TGF-B using Procartaplex Single-plex assay (ThermoFisher).
-
bioRxiv - Genomics 2024Quote: ... Non-lethal genotyping of G3 flies was carried out using single adult legs with Platinum Direct PCR Universal Master Mix (Invitrogen).
-
bioRxiv - Genetics 2024Quote: ... Quantitative RT-PCR analysis of the imprinted genes was performed using the TaqMan Fast Universal PCR Master Mix (Applied Biosystems). Relative quantification of imprinted gene expression was normalized to Actb expression levels and calculated using the ΔΔCt method ...
-
bioRxiv - Physiology 2024Quote: ... RT-qPCR was conducted using Taqman gene expression assays and Taqman Fast Universal Master Mix (Thermo Fisher Scientieic, Waltham, MA) or primers and SYBR Green PCR Master Mix (Thermo Fisher Scientieic ...
-
bioRxiv - Molecular Biology 2020Quote: ... the plate was then read at 450 nm using a Multiskan® EX plate reader (Thermo Scientific), and the data analysed in GraphPad Prism version 7.0c ...
-
bioRxiv - Bioengineering 2021Quote: ... Fluorescence readings were conducted using a Spectramax plate reader in a black-walled clear bottom plate (Nunc), with the excitation/emission for TO1 and TO3 being 510/535 nm and 637/658 nm ...
-
bioRxiv - Microbiology 2021Quote: ... pneumoniae (one colony per species per plate) were further sub-cultured on Sheep Blood Agar plates (ThermoFisher) and species identity confirmed by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS ...
-
bioRxiv - Microbiology 2020Quote: ... The lysates were coated onto the ELISA plate (Nunc-Immuno™ plate; Thermo Fisher Scientific, Roskilde, Denmark). The antigen-coated wells were then blocked with 20% Blocking One (Nacalai Tesque ...
-
bioRxiv - Neuroscience 2021Quote: ... the plate was washed 4 times with PBST using a plate washer (Thermo Fisher Scientific Wellwash Versa), and anti-pTRKB antibody (1:1000 in the blocking buffer ...
-
bioRxiv - Plant Biology 2023Quote: Stratified seeds were germinated on square plates (100 mm × 100 mm square plates; Fisher Scientific; Cat#FB0875711A) containing sterile full-strength (1x ...
-
bioRxiv - Biochemistry 2024Quote: ... if a 96-well plate (SureSTARTTM WebSealTM 96-Well Microtiter Plate, SN: 60180-P210B, Thermo Fisher Scientific) was used for injection ...
-
bioRxiv - Microbiology 2023Quote: ... the plate was transferred to 20° C pre-cooled plate reader (Multiskan GO, Thermo scientific, Waltham, MA) and shaken slowly for 10 seconds ...
-
bioRxiv - Biophysics 2023Quote: 6-well plate cell proliferation – Cells were seeded into 6-well plates (Fisher Scientific, 07-200-83) 150,000 cells/well and left at ambient temperature for 20 minutes to ensure homogeneous settling ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 to 2 µg of RNA was reverse transcribed with the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) using random hexamers for amplification of cellular genes or gene specific primers for amplification of either minus or plus strand viral RNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was synthesized from 2 μg of total RNA using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). The expression of 370 ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (2 µg) was then reverse transcribed with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems; ThermoFisher Scientific). RT-qPCR was then performed via the CFX384 Real Time system (Bio-Rad ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (2 µg) was then reverse transcribed with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems; ThermoFisher Scientific). RT-qPCR was then performed via the CFX384 Real Time system (Bio-Rad ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 µg of the extracted RNA were reverse-transcribed using the high capacity cDNA reverse transcription kit (Applied Biosystems) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... using a 1:2 mass ratio of light and heavy chain DNA with the Expifectamine transfection kit (Life Technologies) as per the manufacturer’s instructions ...