Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for ssc mir 17 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... RT-PCR (Fast 7500 of Applied Biosystems) was performed using TB-Green™ Premix Ex Taq™ II ...
-
bioRxiv - Microbiology 2023Quote: ... with 10X RT PCR buffer (Applied Biosystems), 25mM MgCl2 (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... using the SuperScript RT-PCR kit (Invitrogen). They were cloned into the XhoI-AvrII site of the pEOE-attP-eGFP vector using In-Fusion cloning ...
-
bioRxiv - Microbiology 2023Quote: ... SuperScript IV One Step RT-PCR (Invitrogen) and the forward primer 5’ TGGAACGTTGACCTGAGAGA 3’ and reverse primer 5’ AAGGATACGGTCCGTTCTGA 3’ were used to amplify a missing 689 bp section between the L1 and E6 genes ...
-
bioRxiv - Developmental Biology 2023Quote: ... on the StepOnePlus RT PCR system (ThermoFisher). Data were analyzed using the Delta-Delta-CT method ...
-
bioRxiv - Neuroscience 2021Quote: ... transfected with the miR-499-5p or control mimic (AmbionTM Pre-miR miRNA Precursor: miR-499-5p or Neg Control 1, Thermo Fisher) for 5-6 days ...
-
bioRxiv - Neuroscience 2021Quote: Hippocampal neurons were co-transfected with 300ng of Cav1.2-HA at DIV6 and 10nM of the miR-499-5p or control mimic (AmbionTM Pre-miR miRNA Precursor: miR-499-5p and Neg Control 1, Thermo Fisher), and processed for immunostaining 13 days after ...
-
bioRxiv - Neuroscience 2021Quote: Hippocampal neurons were transfected at DIV 5 with 100ng of GFP alone or co-transfected with 10nM of the miR-499-5p or control mimic (AmbionTM Pre-miR miRNA Precursor: miR-499-5p and Neg Control 1, Thermo Fisher). After 5 days of expression ...
-
bioRxiv - Neuroscience 2021Quote: Hippocampal neurons were co-transfected at DIV 5 with 10nM of the miR-499-5p or control mimic (AmbionTM Pre-miR miRNA Precursor: miR-499-5p or Neg Control 1, Thermo Fisher) and 100ng of the Cacnb2 3’UTR luciferase reporters ...
-
bioRxiv - Pathology 2022Quote: ... RT) washed in 1X Perm buffer (eBioscience™ Foxp3 / Transcription Factor Staining Buffer Set, ThermoFisher, #00-5523-00, 350g, 5min., RT) and incubated with anti-Ter119 (4µg/mL ...
-
bioRxiv - Plant Biology 2020Quote: Lines with defective stomatal responses to at least one stimulus were subjected to sequencing of “usual suspects” either by NGS-based sequencing of PCR amplicons obtained with the use of gene-specific primers (Supplementary Data Set 2) and Phusion DNA polymerase (ThermoFisher Scientific; ROUND 1 to 6), or whole-genome sequencing (ROUND 7 and 8) ...
-
bioRxiv - Microbiology 2022Quote: ... was used for the relative quantification of viral genomic copies using TaqPath and N1 primer-probe set in a qRT-PCR assay (Thermo Fisher Scientific, Waltham, MA, USA).
-
bioRxiv - Pathology 2022Quote: ... Real-time RT-qPCR was performed using SYBR Green probe sets (Applied Biosystems, MA) and a Step One Plus thermal cycler (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2019Quote: The sample sets: (i) CL1_DM1_H-(generated with SuperScript III RT, Invitrogen, Carlsbad, CA, USA) consisted of 3 DM1 samples extracted from DM1 myoblast cell lines (9886 ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was set up with a SYBRTM Green qPCR SuperMix (Thermo Fisher Scientific) in quadruplicate reactions per primer or probe set ...
-
bioRxiv - Microbiology 2019Quote: ... PCR reactions were set up using Phusion High-Fidelity PCR Master Mix (ThermoFisher Scientific) and the following primer pair ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was then performed using AgPath RT-PCR (Life Technologies) kit on a QuantStudio(TM ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-PCR was performed using QuantStudio 3 PCR system (Applied Biosystems) or StepOnePlus Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Neuroscience 2020Quote: ... and miR-9/9*-124 + TuD-miR-124 using TRIzol Reagent (Invitrogen, 15596026) in combination with RNeasy micro kit (Qiagen ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Two different miR-146a mimics (Ambion/Thermo Pre-miR™ and miRVana mimic) were used ...
-
bioRxiv - Cell Biology 2019Quote: ... mRNA knockdown was determined by RT-qPCR (Applied Biosystems 7500 Fast RT-PCR) using 2 independent primer sets for each transcript with Hprt1 and cyclophilin B (Ppib2 ...
-
bioRxiv - Cell Biology 2020Quote: ... using one step TaqMan RT enzyme and TaqMan RT-PCR Mix (Applied Biosystems). Relative quantification from triplicate amplifications were calculated by normalizing averaged threshold cycle (Ct ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR (AgPath-ID™ One-Step RT-PCR Reagents, Applied Biosystems™). The mean number of copies of extracellular viral RNA/μi of supernatant was then calculated (Applied biosystems ...
-
bioRxiv - Genomics 2024Quote: ... samples were washed twice in PBS-T and incubated with 1 µM each sequencing primer (Integrated DNA Technologies) in 2X SSC buffer (Ambion AM9763) for 30 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by reverse transcription with RT primer (CCTTGGCACCCGAGAATTCCA) and SuperScript III (Invitrogen). PCR amplification was done with Q5 and primers with indexes (Forward ...
-
bioRxiv - Immunology 2022Quote: ... RNA was reverse transcribed with SuperScript III RT and random primers (Invitrogen) to synthesize first-strand cDNA ...
-
bioRxiv - Immunology 2024Quote: ... Manual RT-qPCR was carried out using TaqMan primer/probes (Applied Biosystems) with data acquired on a ViiA Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: ... The RT-PCR was performed using the SuperScript III Platinum One-Step Quantitative RT-PCR system (Invitrogen, Carlsbad, CA) on a LightCycler 480 instrument (Roche Diagnostics ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by sequencing via SuperScript III One-Step RT-PCR System with Platinum Taq RT-PCR (Life Technologies, USA) conducted by Life Technologies Biotechnology (Shanghai ...
-
bioRxiv - Microbiology 2020Quote: ... RT-PCR was performed using a Superscript III one-step RT-PCR system with platinum Taq DNA polymerase (Invitrogen) with four sets of specific primers ...
-
bioRxiv - Microbiology 2020Quote: ... RT-PCR was performed using a Superscript III one-step RT-PCR system with platinum Taq DNA polymerase (Invitrogen) with primers covering the entire S segment region according to a previously reported study [9] ...
-
bioRxiv - Molecular Biology 2019Quote: ... RT-PCRs were performed using the One-step Superscript III RT-PCR kit with Platinum Taq polymerase (Life Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The RT-PCR was performed using the SuperScript III Platinum One-Step Quantitative RT-PCR system (Invitrogen, Carlsbad. CA) on a LightCycler 96 or LightCycler 480 instrument (Roche Diagnostics ...
-
bioRxiv - Cell Biology 2022Quote: ... with a one-step RT-PCR kit using Taqman® technology (AgPath-IDTM One-Step RT-PCR, Life Technologies) and using the Applied Biosystems ViiA 7 Real-Time PCR System and the appropriate primers for Taqman assays (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... The RT-PCR was performed using the SuperScript III Platinum One-Step Quantitative RT-PCR system (Invitrogen, Carlsbad, CA) or Taqman Fast Virus 1-step master mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... A multi segment RT-PCR amplification was performed using the Superscript III high-fidelity RT-PCR Kit (Invitrogen, USA). Influenza virus specific primers were used ...
-
bioRxiv - Microbiology 2024Quote: Real-time RT-PCR was performed using AgPath-ID™ One-Step RT-PCR reagents (Applied Biosystems, Product # 4387424) on a StepOnePlus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2021Quote: ... hippocampal neurons were transfected at DIV7 with 10nM of the miR-499-5p or control mimic (Ambion™ Pre-miR miRNA Precursor: miR-499-5p and Neg Control 1, Thermo Fisher) with the Lipofectamine RNAiMAX reagent (Thermo Fisher ...
-
bioRxiv - Immunology 2022Quote: ... and the 2019-nCoV RT-qPCR primers and probe (E_Sarbeco)84 on a StepOnePlus RealTime PCR System (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 µg of RNA was used for reverse transcription by the M-MLV-RT (Life Technology) using oligo(dT) primer and qRT-PCR was performed on a Step One Plus system (Applied Biosystems Version 2.2.3) using SYBR Premix ExTaq reagents and protocol (Takara) ...
-
bioRxiv - Microbiology 2022Quote: RNA was amplified with influenza-specific primers (Hoffmann et al., 2001) using Invitrogen Superscript III One-Step RT-PCR with Platinum Taq (ThermoFisher Scientific, Waltham, USA). The simultaneous amplification of all influenza segments is based on a one-step RT-PCR method along with primers designed to bind to the conserved 3’ and 5’ ends of the segments ...
-
bioRxiv - Genomics 2020Quote: ... cDNA was reverse transcribed from total patient and control RNA samples using random hexamers primers from the SuperScript™ III First-Strand Synthesis System for RT-PCR kit (Invitrogen, Carlsbad, CA) according to manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reverse transcription was carried out using RT primer (TruSeq small RNA kit, RTP) and superscript III RT enzyme (Invitrogen). Library was amplified by 10–14 cycles of PCR using indexing primers (TruSeq small RNA kit ...
-
bioRxiv - Genomics 2020Quote: ... Gene sequences were obtained from Ensembl v92 (www.ensembl.org) and PCR primers (Supplementary Table 16) were designed using Primer Express Software for Real-Time PCR 3.0 (Applied Biosystems). Primer efficiency and specificity were evaluated on genomic DNA in each species ...
-
bioRxiv - Bioengineering 2021Quote: ... We first used the same primer sets and PowerUp SYBR Green MasterMix (Thermo Fisher, A25742) as in the qPCR reactions to amplify the samples for 25 cycles ...
-
bioRxiv - Neuroscience 2021Quote: ... 40X Taqman SNP genotyping assay and custom designed primer-probe set (Life Technologies, Table 1) was used to detect indels ...
-
bioRxiv - Immunology 2021Quote: ... and primers/probes sets targeting SIVmac239 (Eurofins Scientific, USA) or GAPDH (Thermo Fisher Scientific, USA). Reactions were completed in triplicates for 40 cycles using FAM dyes ...
-
bioRxiv - Molecular Biology 2021Quote: ... with specific set of primer pairs (Supp Table 1) using ViiA7 thermal cycler (Applied Biosystems). Changes in threshold cycles were calculated by subtracting the Ct values of the gene of interest from that of housekeeping control (for qRT-PCR ...
-
bioRxiv - Cell Biology 2019Quote: ... the total beads were collected and washed in 6X SSC (diluted from 20X SSC, Invitrogen, #15557044). Excess bead primers without RNA molecules were removed by the treatment of Exonuclease I (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... All pcr primers were purchased from Thermo Fisher Scientific and are listed in Supplementary Table 4 and Table 5.