Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for Contactin Associated Protein Like 3 CNTNAP3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Proteins were resolved by SDS-PAGE on NuPAGE 3-8% Tris-Acetate precast gels (Thermofisher) and protein transfer was achieved using the iBlot™ 2 Gel Horizontal Transfer Device (Thermofisher) ...
-
bioRxiv - Immunology 2020Quote: ... Proteins were transferred to nitrocellulose membrane and blocked with 3% bovine serum albumin (Thermo Scientific) in 1XTBST for 1 hour ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein lysates were loaded on NuPAGE Tris-acetate 3-8% precast gels (EA03752BOX, Life Technologies) and ran at 150V for 1.5h ...
-
bioRxiv - Bioengineering 2019Quote: ... Protein separation was done through electrophoresis using a NuPAGE 3-8% tris-acetate gel (ThermoFisher) with wells loaded with 10 µg of protein ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were separated by electrophoresis through 3-8% gradient SDS polyacrylamide tris-acetate gels (ThermoFisher), and transferred to polyvinylidene fluoride membranes (Cytiva ...
-
bioRxiv - Microbiology 2022Quote: ... or 1-3 µL of PageRuler Prestained Protein Ladder (10-180 kDa) (Thermo Scientific, 26617) were used as a ladder ...
-
bioRxiv - Molecular Biology 2022Quote: ... 15 μg of protein was separated on NativePAGE 3-12% Bis/Tris gel (ThermoFisher, BN1003BOX) and semi-dry blotted to a nitrocellulose membrane and detected as described above.
-
bioRxiv - Neuroscience 2023Quote: ... Samples were run on Nupage™ 3-8% Tris-Acetate Protein Gels (Thermo Scientific, EA03755BOX), using NuPAGE® Tris- Acetate SDS Running Buffer (20X ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein lysates were loaded on NuPAGE Tris–acetate 3–8% precast gels (EA03752BOX, Life Technologies) and subject to electrophoresis at 150 V for 1.5 h ...
-
bioRxiv - Cell Biology 2023Quote: ... and 3 mg of protein lysate was incubated with Dynabeads MyOne Streptavidin C1 (ThermoFisher Scientific) for 1 h at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting supernatant samples were run on 3-12% NativePage Bis-Tris Protein Gels (Invitrogen) with addition of NativePage 5% G-250 Sample Additive (Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: ... Protein A antibody conjugated products were prepared following the protocol of Dynabeads Protein A (Thermo Fisher, 10008D) and incubated with induced yeast libraries at room temperature for 30min with shaking ...
-
bioRxiv - Immunology 2022Quote: ... Protein A antibody conjugated products were prepared following the protocol of Dynabeads Protein A (Thermo Fisher, 10008D) and incubated with induced yeast libraries at room temperature ...
-
The pan-cancer lncRNA PLANE regulates an alternative splicing program to promote cancer pathogenesisbioRxiv - Cancer Biology 2020Quote: ... Protein-antibody complexes were then captured with the Pierce™ Protein A/G Agarose (ThermoFisher Scientific, #20421) at 4°C for 2 hrs with rotation and beads were then rinsed with wash buffer (25 mM Tris ...
-
bioRxiv - Neuroscience 2019Quote: ... sections were washed in PBS (5 × 3 minutes) and then incubated 3 hours in a cocktail of secondary antibodies conjugated to Alexa Flour dyes (Life Technologies) to tag the primary antibodies at a concentration of 1:500 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Antibody shifts were done by incubating the protein/extract with 4uL of antibody (α-Twist: Invitrogen PA5-47824 ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were probed with primary antibodies and detected by incubation with HRP-conjugated secondary antibodies (Invitrogen). The following primary antibodies were used ...
-
bioRxiv - Physiology 2020Quote: ... MCF-10 human mammary epithelial cells and COS-7 fibroblast-like monkey cells were maintained in DMEM (Fisher Scientific) supplemented with 10% fetal bovine serum and 2% penicillin/streptomycin.
-
bioRxiv - Microbiology 2021Quote: ... A549 (male, human lung epithelial-like) cells were obtained from ATCC and grown at 37 °C in DMEM (Gibco) supplemented with 10 % FBS (GE Healthcare Life Science ...
-
bioRxiv - Cell Biology 2022Quote: ... ES03 cells were grown on MEF feeders in KSR+bFGF and passaged enzymatically using trypsin-like enzyme (TrypLE, Invitrogen) for at least 3 passages before electroporation ...
-
bioRxiv - Microbiology 2019Quote: ... The MamK-like gene from strain Poly30T was amplified by standard PCR procedures with Phusion DNA polymerase (Thermo Scientific) using the primers RPA821_NheI (CTAGCTAGCATGACCGACATC ACGACCGAC ...
-
bioRxiv - Microbiology 2021Quote: Green monkey kidney fibroblast-like Cos7 cells were cultured at 37 °C with 5% atmospheric CO2 in Dulbecco’s Modified Eagle Medium (DMEM; Gibco, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... BMEC-like cells in well plates were treated with 10 μM cyclosporin A (CsA; Fisher Scientific #11-011-00), a p-glycoprotein inhibitor ...
-
bioRxiv - Genomics 2021Quote: ... SH-SY5Y neuroblast-like cells were maintained in Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F-12) (Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Cell Biology 2022Quote: ... They were passaged twice weekly by rinsing in phosphate buffered saline and dissociation in Trypsin like-enzyme (ThermoFisher 12604039) before diluting 1:5 into fresh media ...
-
bioRxiv - Immunology 2022Quote: RAW 264.7 murine macrophage-like cells (TIB-71; ATCC) and their derivatives were cultured in RPMI 1640 media (Gibco) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2024Quote: ... African green monkey kidney fibroblast-like cell line (COS-7) was maintained in minimal essential medium (MEM, Gibco/BRL) supplemented with 5% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... They were passaged twice weekly by rinsing in phosphate buffered saline and dissociation in Trypsin like-enzyme (ThermoFisher 12604039) before diluting 1:5 into fresh media ...
-
bioRxiv - Molecular Biology 2020Quote: We quantified cholesterol associated with CD81 using an Amplex Red Cholesterol Assay (Thermo Fisher Scientific, Waltham, MA, USA). Beads were pelleted by centrifugation ...
-
bioRxiv - Cancer Biology 2021Quote: ... The panel comprises markers associated with either a basal (Keratin-17: Thermo Fisher MA513539 and s100a2: Abcam 109494) or classical (cldn18.2 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... RNA quantity was assessed using both a Qubit Fluorometer with associated RNA Broad Range kit (Thermo Fisher Scientific) and an Agilent 2100 Bioanalyzer using a “pico” kit ...
-
bioRxiv - Cell Biology 2020Quote: ... Coverslips were washed 3 times in PBS and secondary antibodies (Oregon Green - Thermofisher O-6382 ...
-
bioRxiv - Neuroscience 2020Quote: ... Secondary antibody incubation was performed for 3-4 days and DiD (Thermo Fisher Scientific-Molecular Probes L7781 ...
-
MK2 deficiency decreases mortality during the inflammatory phase after myocardial infarction in micebioRxiv - Physiology 2023Quote: ... Mouse monoclonal antibodies against GAPDH (glyceraldehyde 3-phosphate dehydrogenase) (# 4300) were from Ambion. Secondary antibodies conjugated with horseradish peroxidase were from Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Molecular Biology 2023Quote: ... and primary antibodies for 3 days: chicken anti-GFP (1:750, Thermo Fisher Scientific Cat# A10262 ...
-
bioRxiv - Developmental Biology 2023Quote: ... species-specific secondary antibodies (Life Technologies; 1:300 dilution in 3% BSA/PBS). Images were collected on a Zeiss Axioimager.D2 upright microscope using a 63x/Plan-neofluar objective and captured using a Coolsnap HQ2 camera (Photometrics ...
-
bioRxiv - Cell Biology 2024Quote: ... and probed with desired antibody in 3% BSA TBST (BSA, BP9703100, Fisher Scientific) overnight at 4C ...
-
bioRxiv - Cell Biology 2020Quote: ... protein lysates were immunoprecipitated with anti-GFP antibody conjugated to protein A-coupled polyacrylamide beads (#53142 Thermo Scientific) for 2 h at 4°C ...
-
bioRxiv - Plant Biology 2021Quote: ... “Protein extracted” with T7 tag antibodies were incubated with protein A containing magnetic beads (Dyna beads, Thermo fisher) for 2 hours at 4 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Beads were prepared by incubating them in 0.5% BSA in PBS and antibodies overnight (100µL of Dynabeads Protein A or Protein G (Invitrogen) plus 20µL of antibody) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Beads were prepared by incubating them in 0.5% BSA in PBS and antibodies overnight (100μL of Dynabeads Protein A or Protein G (Invitrogen) plus 20μL of antibody) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The antibody-DNA complex was precipitated with protein A/G magnetic beads or protein A sepharose beads (Invitrogen). After washing ...
-
bioRxiv - Immunology 2023Quote: ... Protein-antibody complexes were immunoprecipitated by rotating the samples with 40 μL protein A-agarose beads (ThermoFisher Scientific) overnight at 4°C ...
-
bioRxiv - Genomics 2023Quote: ... The antibody-protein complex was recovered with protein A coupled to magnetic beads (Dynabeads, Invitrogen, Cat No. 10002D), followed by extensive washes with low salt immune complex wash buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... The antibody-binding proteins were pulled down using protein A conjugated magnetic beads (Thermo Scientific, Cat No.88845) and washed by repeated centrifugation and homogenization ...
-
bioRxiv - Immunology 2024Quote: ... Antibodies were purified from culture supernatants by protein A agarose beads (Thermo Fisher PierceTM Protein A Agarose, 20333). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Physiology 2020Quote: ... and 3) verify functional cutaneous B2R antagonism via CVC and protein extravascularization (BCA protein assay of dialysate; Thermo Scientific, Waltham, MA, USA; Figure 1D). Increases in skin flux (vasodilation ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) and protein concentrations were determined with a Pierce BCA protein assay kit (Thermo Fisher Scientific, Waltham, MA, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... SNO proteins were detected by the anti-TMT antibody (ThermoFisher Scientific).