Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 7α 12α Dihydroxycholest 4 en 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... Samples were stained 3 days at 4°C with phalloidin (0.66 µM, Alexa Fluor 488, Thermofisher, #A12379) and DAPI (0.3 mg/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... Proteins were separated by NuPAGE 3-8% or 4-12 % Tris-Acetate Midi Gel (Invitrogen, Cat# WG1402BX10) and transferred to nitrocellulose membranes (Fisher ...
-
bioRxiv - Microbiology 2024Quote: ... containing 100 mg/ml of X-gal (5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Thermofisher) to confirm CFU/ml counts.
-
bioRxiv - Cell Biology 2021Quote: ... Sample concentration and purity was determined with the NanoDrop One (ThermoFisher, Cat # ND-ONE-W).
-
bioRxiv - Cell Biology 2024Quote: ... The labeling efficiency was calculated using NanoDrop One Spectrophotometer (Thermo Fisher Scientific #ND-ONE-W). The average probe labeling efficiency was ∼90% ...
-
Efficient Suppression of Endogenous CFTR Nonsense Mutations Using Anticodon Engineered Transfer RNAsbioRxiv - Molecular Biology 2021Quote: ... one-step reverse transcriptase and quantitative PCR (RT-qPCR) was performed on the QuantStudio 3 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) using the Luna Universal One-Step RT-qPCR Kit (New England BioLabs ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5’ TCTCGCTGGGGACTCTGGTTGAAAT 3’) primers (Eurofins, Louisville, KY) and SuperScript™ III One-Step RT-PCR kit with Platinum™ Taq DNA Polymerase (Invitrogen, Carlsbad, CA) using the following thermocycler conditions ...
-
bioRxiv - Physiology 2023Quote: ... The pancreas was removed en bloc via a midline incision and placed in ice-cold modified Hanks’ Balanced Salt Solution (HBSS) (Gibco™, Thermo Fisher Scientific, Waltham, MA) containing 3.25% HEPES (Gibco™ ...
-
bioRxiv - Genetics 2023Quote: ... Secondary metabolites analysis was performed using Acquity ArcSystem HPLC (Waters, Saint-Quentin-en-Yvelines, France) combined with an LTQ Orbitrap XL high-resolution mass spectrometer (Thermo Fisher Scientific, Les Ulis, France). A volume of 10 μL of the suspension was injected into a reversed-phase 150 mm × 2.0 mm ...
-
bioRxiv - Microbiology 2023Quote: ... LC-MS analyses were performed using Acquity HPLC (Waters, Saint-Quentin-en-Yvelines, France) linked to an LTQ Orbitrap XL high-resolution mass spectrometer (Thermo Fisher Scientific, Les Ulis, France). A reversed-phase Luna® C18 column (150 mm × 2.0 mm ...
-
bioRxiv - Cell Biology 2019Quote: ... incubated overnight at 4°C or at room temperature for 4 hrs in one of the following primary antibodies: 1:3000 mouse α-GFP (MA5-15256, Thermo Fisher Scientific), 1:3000 rabbit α-hexokinase (H2035-01 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Secondary antibodies were diluted in blocking solution and incubated with samples for at least one hour and not more than 4 hours as follows: Alexa 488 donkey α-mouse (1:1000, Thermo Fisher Scientific), Alexa 647 goat α-rabbit (1:1000 ...
-
bioRxiv - Plant Biology 2021Quote: ... these were extracted and dialyzed against 25 mM Tris pH 7.5 at 4 °C and measured using a Nanodrop One (Thermo Fisher Scientific, Waltham, MA). Particles for cryo-EM were dialyzed against 20 mM NaOAc ...
-
bioRxiv - Systems Biology 2020Quote: ... and 4 μL of this dilution were used to transform One ShotTM ccd B Survival 2 T1R competent cells (Thermo Fisher Scientific, A10460). Transformants were selected with 33 μg/mL chloramphenicol (Merck ...
-
bioRxiv - Neuroscience 2021Quote: ... preparations were washed six times with PBT and incubated for one night at 4°C with secondary antibodies goat anti-rabbit Alexa 488 (Invitrogen, USA; 1:250) and goat anti-mouse DyLight 649 (Jackson ImmunoResearch ...
-
bioRxiv - Neuroscience 2023Quote: ... The slices were incubated at 4°C for one day in PBT with 0.002% Streptavidin conjugated to Alexa Fluor 633 (ThermoFisher Scientific, Waltham, MA, USA), then washed two times in PBT and two times in PB ...
-
bioRxiv - Plant Biology 2020Quote: ... on 4-16% (Figures 4A and 7) or 3-12% (Figures 4C and 6) NativePAGE gels (Life technologies). Cathode Running buffer (Life technologies ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) was purchased from Invitrogen. Calcein dye ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubated overnight in mouse anti-Hu primary antibody at 4°C (1:200 in 3% block; Invitrogen). After three 5-min PB rinses at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... CHIKV was labeled with the lipophilic fluorescent probe DiD (1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine, 4-chlorobenzenesulfonate salt; Life Technologies), as described previously [5] ...
-
bioRxiv - Neuroscience 2020Quote: ... 4) counterstained with the nuclear dye TO-PRO-3 (diluted 1:10’000; Life Technologies, Inc., Gaithersburg, MD, USA). Finally ...
-
bioRxiv - Cell Biology 2022Quote: ... SDS-PAGE was performed using NuPAGE 4-12% Bis-Tris and 3-8% Tris-Acetate gels (Life Technologies). Nitrocellulose membranes were developed with horseradish peroxidase (HRP ...
-
bioRxiv - Genomics 2019Quote: ... Primary antibodies (anti-human CD47-APC; clone CC2C6, BioLegend, Cat. #323123/4, RRID: AB_2716202/3; and clone B6H12.2, ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: ... at 4°C for 1-3 days followed by secondary antibody (1:500, Thermo Fisher Scientific #A-21206) overnight at 4°C.
-
bioRxiv - Genetics 2020Quote: mRNA was collected from groups of 10 whole larvae (n=3–4 replicates per line) using Trizol (ThermoFisher) and reverse transcribed to cDNA using SuperScript III Reverse Transcriptase (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Antibiotic-Antimycotic Mixed Stock Solution (Nacalai) and were passaged every 3-4 days with TryPLE (ThermoFisher Scientific). For microscopy observations ...
-
bioRxiv - Bioengineering 2020Quote: ... Bodipy FL c16 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid, Thermofisher) was diluted in sterile RPMI-1640 (Corning ...
-
bioRxiv - Molecular Biology 2020Quote: ... a sample of eluates (3%) was separated on acrylamide NuPAGE Novex 4–12% Bis-Tris gels (Life Technologies) and analyzed by silver staining.
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were passaged every 3-4 days with 0.25% trypsin-EDTA solution (Life Technologies, cat. no. 25200-056) and washed with sterile PBS (Life Technologies ...
-
bioRxiv - Biochemistry 2021Quote: ... and then diluted into fresh YPD for 3-4 hours before inoculating into 96-well plates (Thermo Scientific) at a starting OD600 between 0.04 to 0.1 ...
-
bioRxiv - Microbiology 2021Quote: ... Paris) and pCMV-VSV-G at a ratio of 4:3:1 with Lipofectamine 3,000 (Thermo Fisher Scientific). Supernatants were collected 48 h after transfection ...
-
bioRxiv - Biochemistry 2022Quote: ... and then analysed on Novex WedgeWell 4-12 % Tris-Glycine Gels or 3-8 % Tris-Acetate gels (Invitrogen). Tris-Glycine gels were run at 180 V for 1 hour at room temperature ...
-
bioRxiv - Physiology 2022Quote: ... The samples were combined with 1 ml of 3:13 dilution of Erlich’s reagent [1.5 g of 4- (dimethylamino) benzaldehyde (ThermoFisher); 5 ml ethanol ...
-
bioRxiv - Genomics 2023Quote: ... All nuclei were pooled and stained with DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306). Using a FACSAria III cell sorter (BD Biosciences) ...
-
bioRxiv - Immunology 2023Quote: ... 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) substrate (Thermo Fisher Scientific, cat.: 34042) was added and the reaction was terminated after 5 min under running tap water ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Biochemistry 2023Quote: ... the filtered supernatant was loaded onto 3-4 mL immobilized D-galactose gel (Pierce™, Thermo Scientific™) equilibrated by gravity flow with Gal A buffer (50 mM Na-phosphate pH 7.4 ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were marked with 2,3x10-3 µg/µL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 min at RT in the dark ...
-
bioRxiv - Immunology 2023Quote: ... at least 50 000 cells were seeded and incubated for 10min at 37°C with 2mM Bodipy-C11 (581/591) (4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-undecanoic acid; Invitrogen) in PBS ...
-
bioRxiv - Plant Biology 2024Quote: ... or X-Gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside, W5376C; Thermo Fisher Scientific, Guilford, CT). GUS and/or LacZ-stained tissues were cleared for 30 s with 12 % sodium hypochlorite solution before microscopy observations.
-
bioRxiv - Cell Biology 2024Quote: ... and a lentiviral transfer plasmid (2:3:4 ratio by mass) using Lipofectamine 3000 (Thermo Fisher Scientific L3000015). Viral supernatant was harvested 48h after transfection and filtered through 0.45 µm cellulose acetate filters (Corning 431220) ...
-
bioRxiv - Cancer Biology 2024Quote: ... at 95⁰C for 3 min and loaded onto a SDS-polyacrylamide gel (4-12%, Invitrogen NuPAGE, #NP0336BOX). After size separation ...
-
bioRxiv - Microbiology 2020Quote: ... one-step RT-PCR was carried out using a One-step RT-PCR detection kit (Invitrogen). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... One sample was stored dry and one was stored in RNAlater (Thermo Fisher Scientific, Waltham, Massachusetts). All samples ...
-
bioRxiv - Neuroscience 2022Quote: ... The RNA concentration of these samples were quantificated by NanoDrop One (Thermo Scientific, ND-ONE-W). 2 ug RNA per sample were used to reverse transcript the cDNA by QuantScript RT Kit (TIANGEN Biotech ...
-
bioRxiv - Plant Biology 2024Quote: ... Chlorophyll content was measured using a NanoDrop™One/One C Microvolume UV-Vis Spectrophotometer (ThermoFisher) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... labeled peptides on one spin tip from a High-Select™ TiO2 Phosphopeptide Enrichment Kit (capacity of 1–3 mg; Thermo Fisher Scientific, catalog A32993). After preparing spin tips ...
-
bioRxiv - Neuroscience 2021Quote: ... Culture One Supplement (Thermo Fisher Scientific), and L-ascorbic acid (200 µM ...
-
bioRxiv - Immunology 2019Quote: ... only one single crRNA (Thermo Fisher) was mixed with tracRNA (Thermo Fisher ...
-
bioRxiv - Physiology 2021Quote: ... coli (One Shot Top10, Invitrogen C404003) were transformed with pCDH plasmids (Table 1 ...