Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 6 chloro 5 methoxy 3 Pyridinecarboxylicacid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... FIVNC-555p (5’-FAM-CATGGCCACATTAATAATGG CGCA -TAMRA-3’ (Applied Biosystems, CA). These reactions were performed with a Bio-Rad iCyclerTM iQ and analyzed using the manufacturer’s software ...
-
bioRxiv - Cell Biology 2022Quote: ... DLP1-sense strand: 5’-UCCGUGAUGAGUAUGCUUUdTdT-3’ 31 (Ambion, Austin, TX, USA).
-
bioRxiv - Cancer Biology 2019Quote: ... 5’-CAGGGGTGCAGCTTGATTTC-3’ 7500 Fast Real-Time PCR System (Applied Biosystems) using optimized conditions for SYBRGreen I dye system ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA against MyoVa was obtained from Invitrogen (s9207, 5’ GUAUAGUCCUAGUAGCUA 3’) as this was shown to work well by Wu et al (2018) ...
-
bioRxiv - Immunology 2020Quote: ... Reactions were run on a Quantstudio 3 or 5 instrument (ThermoFisher). Cycling conditions for Quantifast reagents were ...
-
bioRxiv - Genomics 2021Quote: ... Linker oligo sequences were: 5’ – TTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNNCAGGCTACTCCGCTTAAGGGAC-3’ (linker 1, Invitrogen, UK) and 5’-GTCCCTTAAGCGGAGTAGCCTG/3AmMO/-3’ (linker 2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using TryplE (Gibco 12604054). Naïve and primed hPSCs were expanded and induced into different lineages in a 5% CO2 incubator at 5% O2 at 37C.
-
bioRxiv - Neuroscience 2023Quote: ... or CRMP2 siRNA (5′ GTAAACTCCTTCCTCGTGT-3′; obtained from Thermo Fisher Scientific) using the 4D-Nucleofector (P3 Primary Cell Solution ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 days after transfection by 5 µl of lipofectamine 2000 (Invitrogen) with 2 µg of the plasmid and regularly re-sorted to maintain expression of myr/palm-mCherry.
-
bioRxiv - Microbiology 2023Quote: ... HSV-1 Probe FAM-5’-CGGCCCAACATATCGTTGACATGGC-3’-MGBNFQ (Thermo Fisher Scientific). The efficiency of each round of PCR was determined using 10-fold dilutions of Topo TA plasmids (Invitrogen AB ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5’- TTGGATCAGCTCAGACATATT-3’ or a nonspecific “scrambled” control (Invitrogen, United States). 72 hours after transfection ...
-
bioRxiv - Molecular Biology 2023Quote: The RNA of 500 µL iRBCs at 3-5% parasitaemia was isolated using 3 mL TRIzol reagent (Invitrogen) followed by phenol-chloroform phase separation ...
-
bioRxiv - Microbiology 2022Quote: ... The F gene was PCR amplified using primers RSV F 5’ (5’GCAAGGATTCCTTCGTGAC3’) and RSV F 3’ (5’CACACCACGCCAGTAG3’) and Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). Sanger sequencing was performed by Elim Biosciences.
-
bioRxiv - Bioengineering 2021Quote: ... 6-well plates were first coated with vitronectin (5 μg/mL, Thermo Fisher, USA) followed by a coating with 10% fetal bovine serum (ThermoFisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... Nuclei were stained with 5 µg / µl 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) and slides were mounted with FluoromountG (SouthernBiotech).
-
bioRxiv - Developmental Biology 2023Quote: ... 5–6 trophectodermal cells were biopsied and their ploidy was assessed by Thermo Fisher Scientific’s NGS technology ...
-
bioRxiv - Neuroscience 2021Quote: ... Nucleus staining was performed using 4’,6-diamidino-2-phenylindole (DAPI) (3 mM, D3571, Molecular Probes). Cells were counted from four randomly selected fields per culture under a confocal microscope (TCS SP8 ...
-
bioRxiv - Cell Biology 2022Quote: ... 3-6 dpf larval zebrafish were anesthetized using 0.2 mg/mL Tricaine-S (Fisher Scientific, NC0872873) solution ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-[6-(4’-hydroxy) phenoxy-3H-xanthen-3-on-9-yl] benzoate (HPF) from Molecular Probes® and Horse radish peroxidase (HRP ...
-
bioRxiv - Physiology 2021Quote: 2-3 viable human slices were incubated with Fluo4-AM (6 μM, Invitrogen cat. No. F1221) for 1h in 3 mM HEPES buffer (125 mmol/l NaCl ...
-
bioRxiv - Biochemistry 2021Quote: ... 3-[p-(6-phenyl)-1,3,5-hexatrienyl] phenylpropionic acid was purchased from Molecular Probes (Eugene, OR, USA) and 1-stearoyl-2-linoleoyl-sn-glycerol-3-phosphocholine (SLPC ...
-
bioRxiv - Biochemistry 2023Quote: ... batches of 3-6 SC-islets were embedded in extracellular matrix (Geltrex, Gibco, cat. n A1569601) and cultured for 7 days under perfusion ...
-
bioRxiv - Cell Biology 2022Quote: ... TcBDF2W92AFw (5’CGACTCCGCTGCGGTTAAAG-3’) and TcBDF2W92ARv (5’-CTTTAACCGCAGCGGAGTCG-3’).The PCR products were first cloned into the pCR2.1-TOPO vector (Invitrogen) and sequenced ...
-
bioRxiv - Immunology 2020Quote: ... 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB (Thermo Fisher Scientific; (Bruner et al., 2016)) ...
-
bioRxiv - Immunology 2020Quote: ... 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB (Thermo Fisher Scientific; (Schmid et al., 2010)).
-
bioRxiv - Genetics 2019Quote: ... 5’-6FAM-CTC AGA CCA GCT GAA G-MGB-3’ (Life Technologies). DENV-1 KDH0026A ...
-
bioRxiv - Microbiology 2021Quote: ... Sections were cut at 3-5 μm on a cryotome (ThermoFisher Scientific) using C35 carbon steel blades (Feather ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 5 μl Turbo DNase buffer and 3 μl Turbo DNase (ThermoFisher Scientific) were added to each reaction and incubated for 30 min at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µM CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher Scientific) were applied for monitoring effector caspase activation and 2.5 µM AlexaFluor647 hydrazide for detecting cell lysis.
-
bioRxiv - Cancer Biology 2022Quote: ... Cell pellet was suspended in 3-5 ml TrypLE Express (ThermoFisher, 12605028) depending on the pellet volume and incubated at 37°C for 10-15 min with mixing every 5 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 10% (for RS-5) or 20% (for DM-3) FBS (Gibco). All the other cells were cultured in RPMI medium (Gibco ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were passaged every 3-5 days using Trypsin-EDTA (Gibco, 25200056). All experiments were done with cells at 10 passages or earlier with regular testing for mycoplasma ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-ATTTGTCGACTCATTCTAATCCTTCGTCTTTTGATT-3′ by using Phusion high-fidelity DNA polymerase (Thermo Scientific) and cDNA prepared from the parasites as template ...
-
bioRxiv - Cell Biology 2020Quote: ... were transfected with human myosin VI siRNA duplex (5′GGUUUAGGUGUUAAUGAAGtt-3′) (Ambion) or AllStars Negative Control siRNA duplex (Qiagen ...
-
bioRxiv - Biophysics 2021Quote: ... LUVs were prepared using sonication (Fisher Scientific, Ultrasonic Bath, 3 × 5 min). Sonication was performed in ice water bath ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl Turbo DNase buffer and 3 μl Turbo DNase (ThermoFisher Scientific) were added to each sample and incubated for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... TOGARAM1 was depleted using siRNA with sequence 5′-CCUCGUAAUUCCUUAGAAA-3′ (Thermo Scientific) Cells were seeded onto coverslips at 70% confluency and transfected with 50 nM of siRNA in two sequential transfections using Lipofectamine RNAiMAX (Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... ID: s2513 (Silencer Select Validated; 5’-GA UAUACCCUGGAAAGUCUtt-3’) (Thermo Fisher Scientific) with JetPrime (Polyplus ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then labelled for Methoxy-X04 (10 minutes at RT) or counterstained with DAPI and mounted with prolong gold anti-fade medium (Invitrogen, P36930). Images were acquired using a Zeiss LSM700 confocal microscope with the Zen 2010 Software package ...
-
bioRxiv - Immunology 2019Quote: ... 5’ ATCCGCACCGACTCGGT 3’ and Rv: 5’ GCGTAATACGACTCACTATAG 3’ and purified using the Quick gel extraction and PCR purification combo kit (00505495, ThermoFisher). The PCR products were confirmed by an agarose gel electrophoresis and by Sanger sequencing (Base Clear ...
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Physiology 2022Quote: ... An aliquot of 100 μL was subsequently derivatized using a final concentration of 10 mM aniline and 5 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (ThermoFisher) for 2 h at 4 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Synthetic Biology 2024Quote: ... the full volume of media in each well was pipetted gently 4-5 times and added to 1 mL of FACS buffer containing 3 uM DAPI (PBS pH 7.4, 2–5 mM EDTA, 0.1% BSA, 3 uM DAPI (Thermo Scientific #62247)) ...
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Neuroscience 2021Quote: ... and 5% (by volume) fluorescent bead solution (6 μm FocalCheck Microspheres; part no. F14807; ThermoFisher), prepared using deionized water ...