Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 6 chloro 5 methoxy 3 Pyridinecarboxylicacid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... against the IAV nucleoprotein (forward: 5’-CAGCCTAATCAGACCAAATG-3’; reverse: 5’-TACCTGCTTCTCAGTTCAAG-3’) were assayed using SYBR Green Master Mix (Applied Biosystems) to confirm viral presence in the maternal lung.
-
bioRxiv - Genetics 2020Quote: ... mouse cDNA was amplified with primers (F: 5-gtttatgggcctcaacctcatg-3, R: 5-caggcttcactccagctttttgg-3) and then enzyme digested with BsiEI (Thermofisher #FD0894). Genotyping result using this method is shown in Fig ...
-
bioRxiv - Cell Biology 2023Quote: ... or Stealth siRNAs targeting coding sequences of human EZH2mRNA (5′-GACCACAGUGUUACCAGCAUUUGGA-3′: EZH2 #1, and 5′-GAGCAAAGCUUACACUCCUUUCAUA-3′: EZH2 #2) were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Genetics 2023Quote: 3 independent total RNA extractions from 30 ovaries from 3-6-day-old RevI-H2i2 flies using Trizol (Invitrogen) were performed ...
-
bioRxiv - Bioengineering 2021Quote: ... The 5(6)-Carboxyfluorescein N-hydroxysuccinimide was purchased from Thermo Fisher Scientific (ON ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5 and 6 dpf with TRIzol reagent (Thermo Fisher Scientific, 15596018) and incubated at 37° C for 30 minutes with RQ1 RNase-Free DNase (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were included in the secondary antibody solution to stain nuclei.
-
bioRxiv - Cell Biology 2023Quote: Tubulin was labelled with (5(6)-TAMRA Succinimidyl Ester (Invitrogen, C1171) for fluorescence microscopy assays according to published methods (Consolati et al ...
-
bioRxiv - Neuroscience 2023Quote: ... or 4°,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were added during the first wash step to visualize nuclei ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 ng/uL human IL-6 recombinant protein (ThermoFisher PHC0066).
-
bioRxiv - Cancer Biology 2021Quote: ... clone IMAGE ID 4977050 was obtained from Source Bioscience and PCR cloned using oligos (Tet2fwd: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAatgccaaatggcagtacagt-3’ and Tet2rev: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTtcatacaaatgtgttgtaag-3’) into pDonor221 (Invitrogen Gateway, ThermoFisher) and sequenced ...
-
bioRxiv - Cell Biology 2020Quote: ... or a 1:1 mixture of two siRNA to CHMP2A (5’-CAGGCCGAGAUCAUGGACAUG-3’ and 5’-GAAGAUGAAGAGGAGAGUGAC-3’) using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the reverse primer containing the Sp6 promoter (5’ ATTTAGGTGACACTATAGCCTCTTCAGTTCCTTCTTCCATC-3’).The aqp1a.1 probe was generated from whole extracted cDNA at 30hpf and amplified with the primers (5’-GTCATGAACGAGCTGAAGAGC-3’) and (5’-GGGTCACTTTGAGGACATCTC-3’),incorporated into the pCR-BluntII-TOPO vector (Invitrogen, 45-0245) (containing both the SP6 and T7 promoters) ...
-
bioRxiv - Genomics 2020Quote: ... The 16S rRNA gene was amplified from the extracted genomic DNA using 16S universal primers 27F (5’-AGA GTTTGATCMTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTTC-3’) and sequenced using an automated ABI3730XL capillary DNA sequencer (Applied Biosystems, USA) for taxonomic identification at Cosmo Genetech (Seoul ...
-
bioRxiv - Microbiology 2020Quote: ... 229E-RP reverse primer (5’-CCAACACGGTTGTGACAGTGA-3’) and the TaqMan minor groove binder (MGB) probe 229E-TP (FAM-5’-TCCTGAGGTCAATGCA-3’-NFQ-MGB; Thermo Fisher Scientific), derived from the HCoV 229E membrane protein gene sequence as described previously (Vijgen et al. ...
-
bioRxiv - Microbiology 2021Quote: The mcr-1 gene was amplified from the clinical isolate ESBL20150072 (European Nucleotide Archive, accession number; SAMEA104060671) using primers: 5’-TTTTGGATCCCGGTTTTCGGGCTTTTTA-3’ and 5’-ATATGTCGACTCAGCGGATGAATGCGGT-3’ and Phusion polymerase (Thermo Fisher Scientific). PCR product was digested with BamHI and SalI and ligated into pACYC184 digested with the same enzymes (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2021Quote: ... PCSK9 mRNA expression was assessed by real-time PCR using PCSK9 primer sets 5’-TGTCTTTGCCCAGAGCATC-3’ and 5’-GTCACTCTGTATGCTGGTGTC-3 (Integrated DNA Technologies) and SYBR Select Master Mix (ThermoFisher, ABI 4472908).
-
bioRxiv - Genetics 2022Quote: ... 5’-GGCAAGCUGACCCUGAAGUdTdT-3’ / 5’-ACUUCAGGGUCAGCUUGCCdTdT-3’ or with a hsa-miR-34a mimic duplex: 5’-P-UGGCAGUGUCUUAGCUGGUUGUU-3’ / 5’-P-CAAUCAGCAAGUAUACUGCCCUA-3’ according to the protocol for Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific).
-
bioRxiv - Plant Biology 2021Quote: ... a fragment containing 2.21 kb upstream regulatory region of ELF3 was amplified from Col-0 genomic DNA using primers ELF3Prom-Fw (5’-CACCCTTATAAATAAAATTCC-3’) ELF3Prom-Rv (5’-CACTCACAATTCACAACCTTTTTC-3’) and cloned into the Gateway System (pENTR™ Directional TOPO® Cloning kit, Invitrogen) to obtain the pELF3-TOPO plasmid ...
-
bioRxiv - Cancer Biology 2019Quote: ... (5’-CUAUGAACAUAAAGUCUGCTT-3’) or its non-specific control (5’-UUCUCCGAACGUGUCACGUTT-3’) were transfected into cells using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA).
-
bioRxiv - Neuroscience 2021Quote: ... Drosophila dSF2 sequence was PCR amplified (dSF2 F 5’-CACCATGGGATCACGCAACGAGTGCCG-3’ and dSF2 R 5’- ATAGTTAGAACGTGAGCGAGACCTGG-3’) was cloned into pEntry-TOPO vector (Thermo Fisher Scientific). The pENTR-dSF2 vector was recombined with Gateway plasmid pTWH (Drosophila Genomics Resource Center ...
-
bioRxiv - Immunology 2022Quote: ... targeting SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA using RNAiMAX (ThermoFisher, 13778-075). 24 h after transfection ...
-
bioRxiv - Microbiology 2022Quote: ... The 16S rRNA gene was amplified with the primers 8f (5′-AGAGTTTGATCCTGGCTCAG-3′; Weisburg et al. 1991) and 1520 r (5′-AAGGAGGTGATCCAGCCGCA-3′; Edwards et al. 1989) (Invitrogen, CA, USA). A volume of 0.5 μL DNA extract was used for 50 μL PCR reactions containing 2 units Taq DNA polymerase ...
-
bioRxiv - Cell Biology 2024Quote: ... For SNX5 and SNX6 the following siRNA sequences were used: SNX5 (5′-UUAGUUUCAGCCCGAAGCAUC-3’), SNX6 (5′-UUAUGAGGUAGACGACUAAAU-3’) (Wassmer et al., 2007), VPS35 (ID 132357, AM16708) (Predesigned – Thermo Fisher Scientific). Nontargeting control siRNA (control ...
-
bioRxiv - Microbiology 2024Quote: ... was added at a 1:2000 dilutions for 1 h at 37 °C, followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Fisher Scientific) for 30 min ...
-
bioRxiv - Microbiology 2024Quote: ... Purified cDNA was amplified for 25 cycles with VSG specific primers: a spliced-leader (5’-ACAGTTTCTGTACTATATTG-3’) and SP6-VSG 14-mer (5’-GATTTAGGTGACACTATAGTGTTAAAATATATC-3’) using Phusion polymerase (Thermo Scientific, F530L) (annealing temp 55C ...
-
bioRxiv - Microbiology 2024Quote: ... 2uL of RNase-treated cDNA was amplified for 35 cycles with VSG specific primers: a spliced-leader (5’-ACAGTTTCTGTACTATATTG-3’) and SP6-VSG 14-mer (5’-GATTTAGGTGACACTATAGTGTTAAAATATATC-3’) using Phusion polymerase (Thermo Fisher, F530L) (annealing temp 55C ...
-
bioRxiv - Cell Biology 2020Quote: ... and Y14 siRNA (5’-GGGUAUACUCUAGUUGAAUUUCAUAUUCAACUAGAG-3’) with Lipo2000 (Invitrogen) in Optimem (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... siDDX42-4: 5’-AUCUCGAAUACCCUUUACG-3’ (ID:136410, Ambion®).
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion) 5’-UGAUUAGUGAUUACCACUGCT-3’ RRM1 (On-Target plus SMARTpool – Dharmacon)
-
bioRxiv - Genetics 2024Quote: ... 5′-UUAAUUUACGCGGUUUUUAUU-3′) using the RNAiMAX transfection reagent (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Larvae (6 dpf) were transferred to a 3 cm Petri dish (Thermo Scientific) and allowed to acclimatize for 5 min before video recording ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 M-tumours and 6 RE-tumours conserved in RNA-later (ThermoFisher,USA) used for RNA extraction ...
-
bioRxiv - Microbiology 2019Quote: ... 6 ug RNA was treated with 3 units of Turbo DNase I (Invitrogen) for 45 min at 37 °C ...
-
bioRxiv - Pathology 2020Quote: ... CHO cells were transfected with 5 ug of human cadherin-6 in pIRES-puro or mouse cadherin-6 in pCDNA3.1 via Lipofectamine 2000 (Invitrogen). After 48hrs ...
-
bioRxiv - Cancer Biology 2019Quote: ... oligonucleotide duplexes were designed against TG2 (sense, 5’-AAGGGCGAACCACCTGAACAA-3’ and antisense, 5’-TTGTTCAGGTGGTTCGCCCTT-3’) and TOPOIIα siRNA (purchased from Thermo Fisher, Catalog # AM16708). Plasmids and miRNA were transfected with Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Microbiology 2020Quote: ... The modified nucleotide 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated by PCR using DreamTaq™ DNA Polymerase (Thermo Scientific™) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole at 5 µg/mL (DAPI; ThermoFisher) in TBS 1% BSA ...
-
bioRxiv - Developmental Biology 2020Quote: ... containing 4’,6-diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Cell Biology 2020Quote: ... Cells were passaged every 5 or 6 days using Versene (Gibco, A4239101). Clinical hESCs were tested weekly for mycoplasma contamination using a Myco-detection Kit (InvivoGen ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 Bcl6 and 6 Smyd2 KO livers using TRIzol reagent (Invitrogen #15596026) followed by purification using the RNeasy Mini kit (Qiagen #74014) ...