Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... 5 mL non-essential amino acids (Gibco), and 5 mL antibiotic-antimycotic (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mL non-essential amino acids (Gibco), and 5 mL antibiotic-antimycotic (Gibco) ...
-
bioRxiv - Biochemistry 2024Quote: hSSB1 and INTS3 proteins were labeled using AF647 dye (Alexa Fluor 647 carboxylic acid succinimidyl ester, Thermo Fisher). The storage buffer was exchanged by dialysis to labeling buffer containing 50 mM MES pH 6.5 ...
-
bioRxiv - Cell Biology 2024Quote: ... zebrafish embryos were anesthetized in 0.02% 3-aminobenzoic acid ethyl ester (tricaine) and fixed in PBS (150mM NaCl, 10mM PO43-, pH 7.4) (Invitrogen) with 4% paraformaldehyde (PFA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Biochemistry 2022Quote: ... mono-reactive NHS ester and NHS-ester conjugated Atto488 (Thermo Fisher) were used ...
-
bioRxiv - Biophysics 2024Quote: ... AlexaFluor 488/647 NHS ester (succinimidyl ester) were obtained from ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... 4,4-difluoro-5-(2-thienyl)-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (BODIPY-C12, Invitrogen D3835), was dissolved in 100% ethanol and conjugated to 10% bovine serum albumin ...
-
bioRxiv - Cell Biology 2021Quote: ... MAN0017058 by Invitrogen (pages 5 and 6). A non-targeting sgRNA that does not recognize any sequence in the human genome was used as a negative control (Invitrogen Cat# ...
-
bioRxiv - Cell Biology 2020Quote: ... pH 8.0) was reacted with a 6-fold molar excess of Alexa Fluor 647 NHS Ester (ThermoFisher, A20006). Excess dye was removed by Zeba Spin column equilibrated in 20 mM Hepes ...
-
bioRxiv - Biophysics 2024Quote: Quantitative determination of intracellular pH (pHi) was performed using the cell-permeant ratiometric pH indicator SNARF™-5F 5-(and-6)-carboxylic acid AM (Thermo Fisher) in live imaged N2a cells at 48 hours of differentiation ...
-
bioRxiv - Bioengineering 2020Quote: ... 2.5 μM of CellTracker™ Orange 5-(and-6)-(((4-chloromethyl)benzoyl)amino)tetramethyl-rhodamine CMTMR (Molecular Probes, C2927) was used to label iNeuron cells ...
-
bioRxiv - Neuroscience 2021Quote: ... incubated 5 minutes with at room temperature with 500 ng/ml 4’,6-Diamidino-2-Phenylindole Dilactate (DAPI; ThermoFisher) in DPBS and mounted in ProLong®Gold (ThermoScientific).
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were stained for 5 min with 1 μg/ml 300 nM 4′,6-diamidino-2-phenylindole (Life Technologies) to visualize nuclei ...
-
bioRxiv - Genomics 2021Quote: The metabolism of 4-hydroxyphenylacetic acid (p-hydroxyphenylacetic acid; Acros Organics, Product code: 121710250) and gentisic acid (2,5-dihydroxybenzoic acid ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Cell Biology 2024Quote: ... 6-((acryloyl)amino)hexanoic acid (Acryloyl-X, SE, A-20770, ThermoFisher); Sodium acrylate (408220 ...
-
bioRxiv - Immunology 2020Quote: ... Transgenic lymph node cells were labelled with 5-carboxyflurorescein diacetate succinimidyl ester (CFSE) (Molecular Probes) as described (14 ...
-
bioRxiv - Immunology 2024Quote: ... according to manufacturer instructions and labeled with 5 M carboxyfluorescein succinimidyl ester (CFSE, Thermofisher Scientific) for 10 min at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... 107 PBMCs/mL were incubated with 5 µM carboxyfluorescein diacetate succinimidyl ester (CFDA-SE) (Invitrogen) for 20 minutes at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... Vybrant CFDA SE Cell Tracer Kit-Carboxyfluorescein diacetate succinimidyl ester (CFSE) (Invitrogen, V12883, 5 µM); CellTrace Violet (CTV ...
-
bioRxiv - Cancer Biology 2023Quote: ... then adding 15 µL of methoxy amine in pyridine (MOX) (Thermo Fisher) and incubating at 40°C for 90 min ...
-
bioRxiv - Bioengineering 2020Quote: ... 4’-6-diamidino-1-phenylindole (DAPI, Life Technologies) was applied at 1 μg/mL for 90 minutes to stain the nuclei and the samples were washed and mounted with AquaPoly/Mount (Polysciences) ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6- diamidino-2-phenylindole (DAPI; Invitrogen D1306) was added during the secondary antibody incubation at a concentration of 700 ng/ml ...
-
bioRxiv - Pathology 2021Quote: ... 4’,6-Diamidino-2-phenylindole (DAPI, D21490, ThermoFisher) stain was done for 15 min at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... and 4’,6-Diamidino-2-Phenylindole (DAPI, Invitrogen). Confocal analyses of stained slides were performed using a TCS SP8 Laser Scanning Spectral Confocal Microscope (LEICA Microsystems) ...
-
bioRxiv - Neuroscience 2022Quote: DAPI (4′,6-diamidino-2-phenylindole, D1306, Invitrogen) staining was performed by incubation at 1:500 for 10 min in DPBS ...
-
bioRxiv - Neuroscience 2022Quote: ... DAPI (4’, 6-diamidino-2-phenylindole, ThermoFisher Scientific) was applied to samples at a concentration of 0.1μg/ml ...
-
bioRxiv - Bioengineering 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher) was added for 30 min at room temperature before the secondary antibodies were washed out in PBS 3x for 15 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... DAPI (4-6-diamindino-2-phenylindole; Molecular Probes) was used to detect DNA ...
-
bioRxiv - Bioengineering 2022Quote: ... DAPI (4’ −6’ -diamino-2-phenylindole, dilactate; Invitrogen) was used for nuclear staining ...
-
bioRxiv - Molecular Biology 2024Quote: 4’,6-diamidino-2-phenylindole - DAPI (Invitrogen, R37606); Ulex europaeus agglutinin-I ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Microbiology 2022Quote: ... 0.1% Triton X-100 in PBS for 20 minutes, then were actin stained with DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride) nucleic acid stain (Thermo Fisher Scientific, USA) in PBS for 10 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Nuclei were counterstained with Hoechst 33342 DNA dye NucBlue® Live ReadyProbes® reagent for live cell imaging or 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI) and SYTO® 60 fluorescent nucleic acid stain for fixed samples (Invitrogen, Molecular Probes, Germany).
-
bioRxiv - Molecular Biology 2022Quote: ... All sections were mounted with 50μl of ProLong Gold Antifade mounting media containing a fluorescent nucleic acid dye 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, P36931) before imaging ...
-
bioRxiv - Bioengineering 2023Quote: ... Alexa Fluor™ 647 NHS ester (succinimidyl ester) was purchased from ThermoFisher Scientific ...
-
bioRxiv - Biophysics 2024Quote: ... and Alexa Fluor™ 647 NHS Ester (Succinimidyl Ester, ThermoFisher, cat# A37573), respectively ...
-
bioRxiv - Biochemistry 2024Quote: ... and G3BP1 were labeled on their N-termini with AF488 (Alexa Fluor 488 carboxylic acid succinimidyl ester, Thermo Fisher). Storage buffer was exchanged to Labeling buffer (50 mM MES pH 6.5 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... succinimidyl ester (AcX) (Invitrogen) was resuspended in anhydrous DMSO (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... succinimidyl ester (ThermoFisher Scientific) and purified via gel filtration to remove excess unconjugated dye ...
-
bioRxiv - Biophysics 2021Quote: ... succinimidyl ester (ThermoFisher Scientific) or Abberior Star 635P (AS635P ...
-
bioRxiv - Biophysics 2020Quote: ... succinimidyl ester (ThermoFisher Scientific) or Abberior Star 635P (AS635P ...
-
Probing Interactions of Therapeutic Antibodies with Serum via Second Virial Coefficient MeasurementsbioRxiv - Biophysics 2021Quote: ... succinimidyl ester (Thermo Scientific). Desalting was carried out using Zeba Spin Desalting Columns (Thermo Scientific) ...
-
bioRxiv - Bioengineering 2022Quote: ... succinimidyl ester (A20000, Invitrogen) to the collagen solution for 1 hr at room temperature ...
-
bioRxiv - Synthetic Biology 2023Quote: ... FITC NHS ester (ThermoFisher), bovine serum albumin (heat shock fraction ...
-
bioRxiv - Immunology 2023Quote: ... succinimidyl ester (ThermoFisher, P36600) were added to the cells in live cell imaging solution ...
-
bioRxiv - Immunology 2024Quote: ... AF594 NHS ester (Invitrogen) was resuspended to 10 mg/mL in anhydrous DMSO and added to SH-01 to a final concentration of 1 mg/mL ...
-
bioRxiv - Biochemistry 2024Quote: ... AlexaFluor488-NHS ester (ThermoFisher), AlexaFluor568-NHS ester (ThermoFisher) ...
-
bioRxiv - Biochemistry 2024Quote: ... AlexaFluor568-NHS ester (ThermoFisher), Cy5-NHS ester (MedChem Express) ...