Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... the samples were centrifuged before receiving 50 µL of N-Methyl-M (trimethylsilyl) trifluoroacetamide (MSTFA) + 1% trimethylchlorosilane (TMCS) (ThermoFisher Scientific, Waltham, MA, USA), briefly vortexed and incubated at 60 °C for 40 min ...
-
bioRxiv - Systems Biology 2021Quote: ... the samples were centrifuged before receiving 50 μL of N-Methyl-M (trimethylsilyl) trifluoroacetamide (MSTFA) + 1 % trimethylchlorosilane (TMCS) (ThermoFisher Scientific, Waltham, MA, USA), briefly vortexed and incubated at 60 °C for 40 min ...
-
bioRxiv - Genomics 2020Quote: ... Primers specific for the methylated bisulphite converted DNA (GAGGAGGAGGGGGTTTGTTAT and AAATCAATAACCTAATAACCACACAC) were designed using Methyl Primer Express (Applied Biosystems, Foster City, CA, USA). After PCR amplification ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Dried samples were dissolved in 250 µl of silylation-grade acetonitrile followed by addition of 250 µl of N-methyl-N- (trimethylsilyl)trifluoroacetamide (MSTFA) with 1% trimethylchlorosilane (TMCS) (Thermo Scientific, Bellefonte, PA) and heated for 1 hr at 70 °C to generate trimethylsilyl derivatives ...
-
bioRxiv - Plant Biology 2022Quote: ... The sample was dried under a stream of air and resuspended in 50μL of N-methyl-N-(trimethylsilyl) trifuoroacetamide (MSTFA) (Fisher scientific, Waltham, MA, USA), votexed to mix for 20 sec ...
-
bioRxiv - Genomics 2023Quote: ... The right femurs of Inbred Founders were dehydrated in ethanol and embedded in poly methyl methacrylate (PMMA) (Thermo Scientific AAA130300F, Thermo Fisher Scientific). Plastic blocks were cut at the midpoint perpendicular to the bone long-axis and trimmed to 5 mm in length ...
-
bioRxiv - Genomics 2023Quote: ... The right femurs of Inbred Founders were dehydrated in ethanol and embedded in poly methyl methacrylate (PMMA) (Thermo Scientific AAA130300F, Thermo Fisher Scientific). Plastic blocks were cut at the midpoint perpendicular to the bone long-axis and trimmed to 5 mm in length ...
-
bioRxiv - Systems Biology 2023Quote: ... Val-Tyr-Val, methoxyamine hydrochloride (MeOX), N-methyl-N-(trimethylsilyl)-trifluoroactamide (MSTFA), and pyridine (Anhydrous, 99.8%) were all purchased from Fisher Scientific (Hampton, NH, USA). Fatty acid methyl esters (FAMEs ...
-
bioRxiv - Cancer Biology 2024Quote: ... Firstly proteins were precipitated with 50 μL of acetonitrile followed by steroid extraction via liquid-liquid extraction with 1 mL tert-methyl butyl ether (MTBE, Acros Organics, Fisher Scientific, UK). The MTBE layer was then removed ...
-
bioRxiv - Neuroscience 2024Quote: ... Two-phase extraction was performed by adding 400 µl of methyl-tert-butyl ether (MTBE): methanol (3:1, v/v; all solvents of High-performance liquid chromatography (HPLC)-grade (Thermo Fisher Scientific, Germany)) ...
-
bioRxiv - Genetics 2024Quote: Seeds were germinated and grown on vertically-oriented ½ MS plates with or without 100μg/ml methyl methanesulfonate (MMS) (Thermo Fisher Scientific, Bohemia, NY) under cool-white fluorescent lights (∼ 100 μmol m−2 s−1 ...
-
bioRxiv - Microbiology 2020Quote: ... 5-(and-6)-carboxyfluorescein (FAM) and 5-(and-6)-carboxytetramethylrhodamine (TAMRA) were obtained from Invitrogen™ ...
-
bioRxiv - Neuroscience 2020Quote: ... DAPI (4’,6-diamidino-phenylindole, Invitrogen) was added to the secondary antibodies solution ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4’,6-diamidino-phenylindole, Invitrogen) was added to the secondary antibody solution ...
-
bioRxiv - Microbiology 2021Quote: ... 1,2-Bis(2-aminophenoxy)ethane-N,N,N’,N’-tetraacetic acid tetraacetoxymethyl ester (BAPTA-AM, Invitrogen), calcium Ionophore A23187 (Sigma) ...
-
bioRxiv - Bioengineering 2024Quote: ... monomer (6-hydroxyhexanoic acid, Thermo scientific 1191-25-9) dissolved in Tris buffer (100mM ...
-
bioRxiv - Cancer Biology 2024Quote: ... recombinant mouse Interleukin-6 (IL-6, 4 ng/mL, Thermo Fisher), recombinant human FMS like tyrosine kinase 3 ligand (FLT3-L ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 μg/mL ascorbic acid (Gibco), and 2.16 g/mL β-glycerolphosphate (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... in 5% acetic acid (Thermo Fisher) to ensure uniform loading ...
-
bioRxiv - Developmental Biology 2024Quote: ... NHS-ester(Succinimidyl Ester) with Alexa 555 (A20009, Invitrogen) was added to the collagen stock at 1:1000 the day before ...
-
bioRxiv - Biochemistry 2021Quote: ... Succinimidyl 6-(4, 4’-azipentanamido)hexanoate (LC-SDA; Thermo Scientific) crosslinking was performed by adding the reagent to final 1mM concentration ...
-
bioRxiv - Biophysics 2022Quote: ... NPE-caged ATP (adenosine 5’-triphosphate, P3- (1-(2-nitrophenyl ethyl) ester) (Invitrogen) dissolved in attachment buffer was photolyzed in the AFM chamber using an UV light source at 340 nm ...
-
bioRxiv - Microbiology 2024Quote: ... bacteria were supplemented with 5 μl of AlexaFluorTM 555 NHS ester (Molecular Probes) at a concentration of 1 mg/ml and left to be stained for 7 min at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... Plates were washed three times with Tris wash buffer and incubated for 1 hr at RT on a plate shaker with 25 μl of 2 μg/ml detection antibody (methyl Tau antibodies (INNOVAGEN) or BT2 (Thermo Fisher, cat. no. MN1010) both labeled with MSD Sulfo-Tag-NHS-Ester (Meso Scale Discovery ...
-
bioRxiv - Cancer Biology 2024Quote: ... Firstly proteins were precipitated with 50 μL of acetonitrile followed by steroid extraction via liquid-liquid extraction with 1 mL tert-methyl butyl ether (MTBE, Acros Organics, Fisher Scientific, UK). The MTBE layer was then removed ...
-
bioRxiv - Plant Biology 2024Quote: ... The powdered plant leaves were dissolved in 300 μl of 1 x non-reducing SDS buffer with or without 8 mM methyl-PEG-maleimide reagent (Thermo Scientific, Cat. No. 22713). After incubation at 25 °C for 1 h in the dark with shaking ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclei were stained for 5 minutes with 1 µM 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Invitrogen), coverslips were mounted on glass slides with mounting medium (Dako) ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-cytokeratin 5/6 (Invitrogen, MA191106) (1:100 ...
-
bioRxiv - Biophysics 2024Quote: ... and both MAb1 and MAb11 were separately mixed with 5 μl of Alexa Fluor™ 647 NHS Ester or Alexa Fluor™ 568 NHS Ester (Thermo Fisher Scientific) in DMSO (10 mg/ml ...
-
bioRxiv - Biophysics 2020Quote: ... incubated with (N-γ-maleimidobutyryl-oxysuccinimide ester) crosslinker (4 mM in ethanol, Thermo Scientific), rinsed with ethanol and dried thoroughly in a sterile biosafety cabinet ...
-
bioRxiv - Biochemistry 2020Quote: Acetic Acid (Fisher Scientific, Cat. # 351269-4)
-
bioRxiv - Biochemistry 2021Quote: Acetic Acid (Fisher Scientific, Cat. # 351269-4)
-
bioRxiv - Bioengineering 2021Quote: Protein supernatants were then labelled with Alexa Fluor® 555 carboxylic acid succinimidyl ester (AF555) (ThermoFisher Scientific) essentially as previously described [76] ...
-
bioRxiv - Biophysics 2022Quote: ... Fluorescent G-actin was prepared by labelling G-actin with AlexaFluor 488 carboxylic acid succimidyl ester (Invitrogen, through Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: hSSB1 and INTS3 proteins were labeled with AF647 (Alexa Fluor 647 carboxylic acid succinimidyl ester, Thermo Fisher). Proteins were dialyzed against Labeling buffer (50 mM MES pH 6.5 ...
-
bioRxiv - Biochemistry 2020Quote: ... 500 mM 6-aminohexanoic acid) was added to lysates right before loading samples into a NativePAGE Bis-Tris gel 4-16% (Life Technologies). The proteins were separated according to Wittig et al.32 and transferred onto a PVDF membrane using a standard Tris-glycine transfer buffer with 0.05% SDS ...
-
Revisiting the role of Toxoplasma gondii ERK7 in the maintenance and stability of the apical complexbioRxiv - Microbiology 2021Quote: ... The NHS-Ester staining (Thermofisher, DyLight™ 488 NHS Ester) was used at 5μg/mL and incubated 1 hour in PBS ...
-
bioRxiv - Bioengineering 2020Quote: ... DAPI ((4’,6-diamidino-2 phenylindole, Invitrogen) was added and samples were covered with coverslips ...
-
bioRxiv - Developmental Biology 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) was added to embryos (10 μg/mL in PBST ...
-
bioRxiv - Bioengineering 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen) allowed visualization of the nucleus (1:5000 dilution) ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μM Hoechst 33342 nucleic acid stain (Thermo Fisher Scientific) was added to each well at least 1 hour before images were taken ...
-
bioRxiv - Cell Biology 2023Quote: ... succinimidyl ester (Invitrogen) was mixed with fibrinogen solution in a 7.5:1 molar ratio for 1 hour at room temperature and then filtered through a HiTrap desalting column (GE Healthcare ...
-
bioRxiv - Biophysics 2022Quote: ... succinimidyl ester (Invitrogen), as previously described [59] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and 5-carboxyfluorescein diacetate acetoxymethyl ester (CFDA-AM; Thermo Fisher Scientific, Waltham, MA, USA). Cells were washed with phosphate-buffered saline (PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... Stock solutions of calcein acetomethyl ester (CAM; 5 mg/ml) (Thermo Fisher Scientific, C3100MP), propidium iodide (PI ...
-
bioRxiv - Immunology 2023Quote: ... cells were labeled with 5 μM carboxyfluorescein succinimidyl ester (CFSE; Life Technologies; Cat # C34554). For Day 2 studies ...
-
bioRxiv - Physiology 2024Quote: ... Exendin-4-BSA-AF647 (Ex-4-BSA-AF647) was obtained by conjugation of Ex-4-BSA with Alexa Fluor 647 NHS ester (#A20006, Invitrogen) according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: ... 5 mM non-essential amino acids (Gibco), 5 mM HEPES (Gibco) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5% (v/v) acetic acid) (ThermoFisher, A40000279) to visualize the proteins run on the paper ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5% non-essential amino acids (Gibco). Cells were maintained at 37 °C in a 5% CO2 environment with saturated humidity.