Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 5 tert butoxy 5 oxopentanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Incubation in prehybridization buffer (5× sodium saline citrate buffer [SSC], 5× Denhardt’s solution [ThermoFisher Scientific] ...
-
bioRxiv - Biophysics 2019Quote: ... 5 μL of 5 mg/mL streptavidin-labeled with Alexa Fluor 488 (ThermoFisher Sci.) was added for 30 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: Oligonucleotides ssDNASel25 (5’GGACAGGAAUUAAUAGUAGCUGUCC3’) and FITC(5’)-ssDNASel25 oligonucleotides were obtained from Invitrogen (USA), Cy5-DNA (5’ Cy5-AAACTATTATTACTCATTTTCCGCCAGCAGTCAACTTCGATTTAATTCGTAAACAGATCT3’ ...
-
bioRxiv - Bioengineering 2022Quote: ... 5% CO2 and 5% O2 in Essential 8 medium (Thermo Fisher Scientific, Waltham, MA) on Matrigel- (BioStrategy ...
-
bioRxiv - Biochemistry 2022Quote: 5 μM purified PWWP domain was incubated with 5× SYPRO Orange (Thermo Fisher Scientific) in assay buffer (20 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2022Quote: ... stained with 5 μM DRAQ5 (Thermo Scientific, nuclear dye, 5 minutes at 37°C), fixed in 4% paraformaldehyde for 20 minutes ...
-
bioRxiv - Biochemistry 2022Quote: 5 μg of purified protein was mixed with 5× SYPRO orange (Thermo Fisher Scientific) in 20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Immunology 2021Quote: ... and 5’ Rapid amplification of complementary DNA (cDNA) ends (5’RACE, Invitrogen, 18374-058) method as described previously20,21 ...
-
bioRxiv - Immunology 2021Quote: ... 5 ng/mL IL-1β and 5 ng/mL IL-23 from Invitrogen (14823163) (Th17.1s ...
-
bioRxiv - Molecular Biology 2023Quote: ... pH 7.0) and 2 µg anti-5-methylcytosine (5-mC) antibody (Thermo Fisher, 33D3), and incubated at 4°C overnight with rotation ...
-
bioRxiv - Cell Biology 2023Quote: ... equipped with a PEPMAP100 C18 5 µm 0.3 × 5 mm trap (Thermo Fisher Scientific) and an HSS-T3 C18 1.8 μm ...
-
bioRxiv - Cell Biology 2023Quote: ... sense 5’-CUACAAAGCUGAUGAAGAC-3’ and antisense 5’-GUCUUCAUCAGCUUUGUAG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... RPMI with 5% fetal bovine serum and 5 μM Lysotracker deep red (ThermoFisher Scientific) was used following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Microbiology 2024Quote: ... Nuclei were stained for 5 minutes in 5 μg/ml Hoechst 33258 dye (Thermofisher), and washed twice more in 1x PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μg/ml blasticidin (Invitrogen) and 200 μg/ml zeocin (Invivogen ...
-
bioRxiv - Immunology 2021Quote: ... 5% penicillin-streptomycin (PenStrep, Gibco), 1x MEM non-essential amino acids solution ...
-
bioRxiv - Cell Biology 2020Quote: ... + 5% FBS (Gibco, 16140-071) + 1% Pen-Strep (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 5% FCS (Gibco), 25 nM β-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 mM EDTA (ThermoFisher Scientific) at 37 °C for 20 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 µL SuperaseIN (Invitrogen) in 100 µL total volume at 37 °C for 20 min ...
-
bioRxiv - Genomics 2020Quote: ... 5% AA (Gibco® MEM), Non-Essential Amino Acids ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5% penicillin and streptomycin (Gibco), and L-glutamine (Gibco) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5% penicillin and streptomycin (Gibco), and L-glutamine (Gibco) ...
-
bioRxiv - Bioengineering 2019Quote: ... 5 µg/ml fibronectin (Invitrogen) was added during overnight ligand incubation to promote cardiomyocyte attachment to the tissue culture surfaces.
-
bioRxiv - Neuroscience 2019Quote: ... containing DRAQ-5 (Thermo Fisher, 62251 ...
-
bioRxiv - Neuroscience 2019Quote: ... and 5% goat serum (Gibco)) ...
-
bioRxiv - Neuroscience 2019Quote: ... and 5% goat serum (Gibco)) ...
-
bioRxiv - Cancer Biology 2019Quote: 5 μM MitoSOX Red (Invitrogen) was added to cells in HBSS for 30 min followed by washing ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... supplemented with 5% FBS (Gibco), 2 mM L-Glutamine (Sigma) ...
-
bioRxiv - Immunology 2019Quote: ... containing 5% FBS (Gibco, 26140079) and 10mM EDTA ...
-
bioRxiv - Pathology 2020Quote: DRAQ-5 (Thermo Fisher, 62251) was used at a dilution of 1:500 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 5% heat inactivated FBS (Gibco) and penicillin-streptomycin (100 units/mL ...
-
bioRxiv - Cell Biology 2019Quote: ... with 5% Horse serum (Invitrogen), 20ng/ml EGF (Peprotech) ...
-
bioRxiv - Bioengineering 2021Quote: ... containing 5% FBS (Gibco 16000069) and 2% B27 (Gibco A1895601) ...
-
bioRxiv - Bioengineering 2020Quote: ... with 5% BME (Fisher Scientific) were subjected to SDS-PAGE using NuPAGE™ 10% Bis-Tris Gels (Invitrogen ...
-
bioRxiv - Bioengineering 2020Quote: ... supplemented with FBS 5% (Gibco) and penicillin/streptomycin 1% (Biowest) ...
-
bioRxiv - Neuroscience 2020Quote: ... supplemented with 5% FBS (Invitrogen) with or without 400 μg/ml geneticin ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 mM EDTA (Life Technologies), 0.2% Phenol Red (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing 5% horse serum (Invitrogen), 20 ng/ml EGF (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 x Denhardt’s solution (Invitrogen), 5 mM EDTA (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5% acetonitrile (Applied Biosystems, 400315), and 0.01% ProteaseMAX surfactant (Promega ...
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 5% FBS (Invitrogen), 5μg/ml insulin (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μM paclitaxel (Thermo Fisher) was added during imaging ...
-
bioRxiv - Cancer Biology 2019Quote: ... plus 5% horse serum (Gibco). SUM102PT cells were obtained from Asterand Biosciences and cultured in Ham’s F-12 (Gibco ...
-
bioRxiv - Systems Biology 2020Quote: ... 5% goat serum (ThermoFisher Scientific), 0.5% mouse serum ...
-
bioRxiv - Microbiology 2020Quote: ... and a QuantStudio 5 (ThermoFisher). Data were analyzed using the comparative 2-ΔΔCt method ...
-
bioRxiv - Microbiology 2020Quote: ... 5 mM MgCl2 (Fisher Scientific), 8.66 mM K2HPO4 (Fisher Scientific) ...