Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for 5 tert butoxy 5 oxopentanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 0.1% sodium dodecyl sulfate and 5 mM ethylenediaminetetraacetic acid with protease and phosphatase inhibitors (Thermo Fisher Scientific). Cell lysates were centrifuged at 500 g for 30 minutes at 4°C to remove cellular debris ...
-
bioRxiv - Biochemistry 2023Quote: ... and 5 μM diethyldithiocarboxamic acid ammonium salt (all reagents from either Thermo Fisher Scientific or Sigma Aldrich). CMH aliquots were stored at -20°C until use ...
-
bioRxiv - Cell Biology 2024Quote: ... Peptides were extracted by incubating with 100% ACN followed by 50% ACN/5% formic acid (Thermo Fisher) for 15 mins each at 37°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... and ITS (5 μg/mL insulin, 5 μg/mL transferrin and 5 ng/ml sodium selenite, Invitrogen). SK-N-BE (2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% CO2 incubator with 5 μM MitoSox Red (Thermo Fisher) in MAS (70mM sucrose ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Pathology 2022Quote: ... 5 mg of 5-ethynyl-2′-deoxyuridine (EdU, A10044, Invitrogen) was dissolved in 1 ml of PBS as a stock solution ...
-
bioRxiv - Genetics 2020Quote: ... each well contained: 5 μL 5× Phusion HF buffer (ThermoFisher), 17.25 μL dH2O ...
-
bioRxiv - Microbiology 2021Quote: ... 5% A+ human serum and 5% AlbuMAX II (Life Technologies). Gametocyte media was changed daily without the addition of fresh erythrocytes for 14 days following induction ...
-
bioRxiv - Neuroscience 2022Quote: ... 5% Pen-Strep and 5% glutamine (Thermo Fisher Scientific #25030081) 1-2 hours before transfection ...
-
bioRxiv - Developmental Biology 2022Quote: ... or 0.2 mM 5-ethynyl uridine (5-EU) (Thermo Fisher) in media for 30 minutes according to kit instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and m7 G(5′)ppp(5′)G Cap Analog (Ambion). BHK-21 cells in 6-well plates were transfected with the capped-SINV-AaBec243-260-mCh-Flag or capped-SINV-mCh-Flag mRNA using Lipofectamine LTX (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 % HEPES (GIBCO), 5 % sodium bicarbonate (GIBCO) ...
-
bioRxiv - Genomics 2020Quote: ... GeneMapper 5 (ThermoFisher) software was used to analyze the peaks.
-
bioRxiv - Immunology 2021Quote: ... 5% FBS (Gibco); 10 µM HEPES (Sigma) ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% BS (Gibco), 1% penicillin-streptomycin (Gibco) ...
-
bioRxiv - Bioengineering 2022Quote: ... + 5% FBS (Gibco). Primary human T-Cells (Peripheral Blood ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5% FCS (Invitrogen), 5% human serum (HS) ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% FCS (Gibco), and 1x penicillin-streptomycin (Gibco ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5% FBS (GIBCO), 1% Penicillin/Streptomycin (GIBCO) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% FBS (Gibco), insulin 10 µg/mL (Millipore Sigma I3536) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5% FBS (Gibco)" ...
-
bioRxiv - Immunology 2021Quote: ... tert-butyl hydrogen peroxide was obtained from ACROS Organics; Oxidized and reduced L-Glutathione were obtained from Alfa Aesar ...
-
bioRxiv - Biochemistry 2022Quote: ... and 5 µg/mL and 5 units/mL penicillin-streptomycin (Gibco). One T175 flask of HEK293 cells of 70% confluency per condition was transiently transfected using 90 µg of EGFP-PABPi or EGFP-PABPi mut ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 U/ml penicillin and 5 U/ml streptomycin (Invitrogen, USA). Cells were plated on poly-D-lysine (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... using forward primer 5’-CACAGGAAGCCCTGGAAGCT and reverse primer 5’-GAGCAGGTCAGGTTTTTGGA (Invitrogen). SIGLEC22P was amplified similarly with forward primer 5’-GCACCTCAGAGTGGAAGGAC and reverse primer 5’-GAAGGGGTGACTGAGGTACA ...
-
bioRxiv - Cell Biology 2021Quote: ... with forward primer 5’-GCACTTGCAGCCGGATTTTTGGATCCATAGCCAGGGCC and reverse primer 5’-GGCCCTGGCTATGGATCCAAAAATCCGGCTGCAAGTGC (Invitrogen) to generate the pcDNA3.1-KIR-CD33-V5/HIS vector ...
-
bioRxiv - Biochemistry 2024Quote: hSSB2 was labeled with 5-IAF (5-iodoacetamido-fluorescein, Thermo Fisher) on the intrinsic cysteines ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 µL of 5% ammonium persulfate (APS) (Thermo Scientific, 17874). 50 µl was added to a strip of parafilm in a humidity chamber on ice ...
-
bioRxiv - Biophysics 2023Quote: ... samples were incubated with a 5 μM DRAQ-5 (Thermo Scientific) DNA staining buffer at 37° C for 30 minutes with agitation ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.3 × 5 mm trapping column (5 µm, 100 Å, Thermo Scientific) and analyzed by nanoLC-ESI-MS/MS analysis using a Thermo Ultimate 3000 RSLC nanoUPLC coupled online to an Orbitrap Exploris™ 240 mass spectrometer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... containing 5 unit/mL penicillin and 5 ug/mL streptomycin (Gibco).
-
bioRxiv - Plant Biology 2022Quote: ... an additional cleaning step with acid phenol was added before precipitation of the RNA by adding an equal volume of Acid-Phenol:Chloroform 5:1 solution pH 4.5 (Ambion). Total RNA was quantified with a Nanodrop 2000 spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was stained with Sytox green nucleic acid stain (5 mM solution in DMSO from Thermo Fisher Scientific) and analyzed on a BD Accuri flow cytometer.
-
bioRxiv - Cell Biology 2019Quote: ... for 10 minutes, and fixed with methanol:glacial acetic acid, (5:1, v/v) (FisherThermo Fisher Scientific, Rockford, IL). Cells were dropped onto slides ...
-
bioRxiv - Genetics 2020Quote: ... and in some cases day 5 (120 hours) by staining with SYBR Green 1 nucleic acid stain (Invitrogen, ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... were harvested in an Eppendorf tube and resuspended in 0.5 mL NaCl (0.85%) containing SYTO9 green-fluorescent nucleic acid stain (5 nM final concentration, Invitrogen). Following incubation in the dark for 5 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Peptides reconstituted with 5% acetonitrile/0.1% formic acid were quantified using Quantitative Colorimetric Peptide Assay (Thermo Fisher Scientific) and 10 µg of peptides for each sample were labeled with 50 µg of TMTpro16-plex reagents (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2022Quote: The GyrA14-E487C and the CcdA50-72 peptide (Table S1) were labeled with Fluorescein-5-Maleimide and 5-TAMRA (Tetramethylrhodamine-5-Maleimide) from ThermoFisher Scientific as per the manufacturer’s protocol as described previously (Aghera et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU; 5 mg per kg body weight, Invitrogen) dissolved in sterile phosphate buffer solution (PBS ...
-
bioRxiv - Biophysics 2021Quote: ... 5 μL of PAA premixes with 5% streptavidin–acrylamide (ThermoFisher, Cat#S21379) of the defined rigidity 48 were promptly sandwiched between the activated dish and the micropatterned coverglass immediately after adding a curing catalyst (aminopropyltriethoxysilane (APS)) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mM MgCl2 and 5 or 10 mM caged ATP (#A1048 Invitrogen) prior to membrane wrapping ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μM of 20-base model RNA (5’-AAUCUAUAAUAGCAUUAUCC-3’; ThermoFisher Scientific) was treated with 300 nM of purified recombinant SARS-Cov2 NSP13 with an N-terminal His-tag (Cayman Chemicals #30589 ...
-
bioRxiv - Microbiology 2023Quote: ... 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated into a PCR by the use of a DreamTaqTM DNA Polymerase (Thermo Scientific™ ...
-
bioRxiv - Immunology 2023Quote: ... mice were injected with 5 μg FK506 (Invitrogen Cat. #INH-FK5-5). Thymi were taken for flow cytometry 24 or 48h after FK506 was administered ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2024Quote: ... The PepMap100 C18 (5 μm 0.3 x 5 mm, Thermo Fisher Scientific) and the ACQUITY BEH C18 (1.7 µm 1.0 × 100 mm ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 5 μl/IP anti-GFP (A-11122, ThermoFisher, 5 ul/IP), for 3 hours at 4°C ...