Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 3 2 Methoxy phenoxymethyl piperidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Proteins were migrated for 2-3 h at 120 V in NuPAGE MOPS SDS running buffer (#NP0001, Invitrogen) and transferred onto a PVDF membrane (#1704156 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mix 1 contains 3 siRNAs (CliniSciences, CRH7929) and Mix 2 contains two siRNAs (ThermoFisher Scientific, 1299001 and 4392420). As a negative control ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were marked with 2,3x10-3 µg/µL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 min at RT in the dark ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 μl of cDNA were mixed with 3 μl of PowerUp™ SYBR™ Green Master Mix (ThermoFisher) containing 1 μM of forward and reverse primer ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were passed every 2-3 days upon reaching ∼80% confluence using 0.05% trypsin-EDTA (Thermo Fisher Scientific) for dissociation.
-
bioRxiv - Molecular Biology 2024Quote: ... Other PCR products were run on 2 or 3% agarose gels containing Sybr Safe DNA stain (Invitrogen, #S33102) and imaged on a ChemiDoc imager.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Cell viability was measured with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Thermo Fisher Scientific, M6394). After cell exposure to AG490 and MeHg at specified times and concentrations ...
-
bioRxiv - Bioengineering 2024Quote: ... VSV-G expression plasmid and pUC19 plasmid (2:3:4 ratio by mass) using Lipofectamine 3000 (Thermo Fisher). The media was changed 6 hours post-transfection and was collected for downstream processing 48 hours post-transfection.
-
bioRxiv - Cell Biology 2024Quote: ... and IPF fibroblasts underwent the 3-(4,5-Dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT) assay (ThermoFisher Scientific, M6494) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... The same test was done in parallel to assess the cell viability using MTT at 5 ug/mL (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) (Invitrogen). Sixteen sites per well were acquired using a 20x Olympus objective plan fluorite NA 0.45 (1320517 ...
-
bioRxiv - Biochemistry 2024Quote: ... and 3 were cleaved from IgGs using Pierce Mouse IgG1 Fab and F(ab’)2 Preparation Kit (ThermoFisher) using protocols provided by the manufacturer ...
-
bioRxiv - Cancer Biology 2021Quote: Relative cell proliferation rates were assayed using an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay kit (Vybrant™ MTT Cell Proliferation Assay Kit, Invitrogen™ ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 μL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, concentration 5 mg/mL, Invitrogen, cat. M6494) in PBS was added to each well containing culture medium and incubated for 2.5 h at 37 °C ...
-
bioRxiv - Bioengineering 2021Quote: ... Medium was changed every 2-3 days and cell passages were carried out using a TrypLE Express solution (Gibco). Human TERT-immortalized gingival fibroblasts (hTERT-HGF ...
-
bioRxiv - Neuroscience 2020Quote: ... pooled and purified cDNA libraries with mean sizes of 550-600 bp and concentrations of 2-3 ng/µl (measured with Qubit 2.0, Invitrogen) were sequenced on a HiSeq 2500 Illumina system with single-end 50 bp read lengths ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 and 3 (100 pmol for each) or control siRNA were transfected into HeLa cells using Lipofectamine 2000 (Invitrogen). 48 h after transfection ...
-
bioRxiv - Microbiology 2021Quote: ... After incubation for 2 h at 37°C the medium was aspirated and 3 mL of fresh DMEM (Gibco) supplemented with 5% New Born Calf Serum (NBCS ...
-
bioRxiv - Microbiology 2021Quote: ... The other half of the wells of the Caco-2 cells was subsequently incubated anaerobically for 3 h with 0.3% gentamicin (50 μg/ml, Gibco) to eliminate all extracellular L ...
-
bioRxiv - Microbiology 2021Quote: ... The other half of the wells of the Caco-2 cells was subsequently incubated anaerobically for 3 h with 0.3% gentamicin (50 µg/ml, Gibco) to eliminate all extracellular L ...
-
bioRxiv - Cell Biology 2021Quote: ... under 5% CO2 at 37°C in humidifying conditions and passaged every 2-3 days using 0.25% Trypsin-EDTA (25200056, Gibco). Cells were routinely tested for mycoplasma ...
-
bioRxiv - Cancer Biology 2021Quote: Relative cell proliferation rates were determined using an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay kit (Vybrant™ MTT Cell Proliferation Assay Kit, Invitrogen™ ...
-
bioRxiv - Microbiology 2022Quote: ... A total of 3 µg of RNA was DNAse treated using 2 units of Turbo DNase I enzyme (Invitrogen). A total of 1 µg of DNAse-treated RNA was reverse transcribed using Superscript III reverse transcriptase (Invitrogen/Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell viability was determined by the MTT [3-(4,5-di-methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (Invitrogen, Waltham, MA) reduction assay ...
-
bioRxiv - Molecular Biology 2022Quote: ... Secondary antibodies were applied for 2 hours in PBS/3% milk powder containing 1 μg/ml Hoechst-33342 (Invitrogen) or DAPI (Roche ...
-
bioRxiv - Neuroscience 2021Quote: ... The culture medium was changed every 2 to 3 days and the cells were split every 5 to 7 days using 0.25% Trypsin-EDTA (Gibco), up to 20 times ...
-
bioRxiv - Cancer Biology 2021Quote: ... conditioned media was replaced by a 1.2 mM 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Thermo Fisher Scientific) solution ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were marked with 2,3×10−3 μg/μL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 minutes at room temperature in the dark ...
-
bioRxiv - Immunology 2020Quote: ... 1×106 cells per condition were plated in 96 U-shape well plates (CELLSTAR, Kremsmünster) and rested for 2-3 h in RPMI (Gibco), supplemented with 10% FBS ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and cell viability was then determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) cell viability assay (Invitrogen, USA) according to the manufacturer’s protocol 28 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The reaction solution was vortexed for 2-3 seconds to avoid bubbles and added to 384-well plate (Nunc™ MicroWell™ 384-Well Optical-Bottom Plates ...
-
bioRxiv - Cell Biology 2020Quote: ... 2×106 NP-TTD were transfected with 3 µg plasmid via electroporation using Neon™ Transfection System (MPK1096, Invitrogen) with following parameters ...
-
bioRxiv - Neuroscience 2021Quote: ... Activated/Cleaved Caspase-3 (1:1000; Cell Signalling Biology, CAT#: 9661S and Thermo Fisher Scientific, CAT#: 66470-2-IG), Nestin (1:1000 ...
-
bioRxiv - Molecular Biology 2022Quote: Fresh tissue samples were washed 2–3 times in PBS and incubated in 5 U/ml dispase (ThermoFisher Scientific) supplemented with antibiotics (penicillin 50U/I and streptomycin 50 mg/ml ...
-
bioRxiv - Bioengineering 2022Quote: ... 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) (16:0 NBD) were purchased from Invitrogen. Phosphate-buffered saline (PBS ...
-
bioRxiv - Biochemistry 2022Quote: ... 4,4-difluoro-5-(2-thienyl)-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (BODIPY-C12, Invitrogen D3835), was dissolved in 100% ethanol and conjugated to 10% bovine serum albumin ...
-
bioRxiv - Neuroscience 2023Quote: Cellular viability was determined utilizing a MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay (Invitrogen, Waltham MA), as described previously (Kumar et al. ...
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 3’ end RNA was synthesized by in vitro transcription using an mMESSAGE mMACHINE T7 kit (Invitrogen) with a DNA template (5’- TAATACGACTCACTATAGCTATCCCCATGTGATTTTAATAGCTTCTTAGGAGAAUGACGTAGCATGCTACGCG -3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... We reverse-transcribed ∼2-3 µg DNase treated RNA into cDNA using Superscript III Reverse Transcriptase (Invitrogen no. 18080093). For each reaction ...
-
bioRxiv - Neuroscience 2024Quote: ... The passage was performed twice per week (1:2 or 1:3) using Accutase (Cat #A1110501, Thermo Fisher Scientific) by vigorously breaking pellets to remove neuronal cells ...
-
bioRxiv - Cell Biology 2024Quote: ... equipped with a trapping column (3 µm C18 particle, 2 cm length, 75 µm ID, Acclaim PepMap, Thermo Scientific) and a 50 cm long separation column (2 µm C18 particle ...
-
bioRxiv - Genomics 2023Quote: ... and 100 μg/ml cycloheximide using Beckman Coulter UC tubes 9/16 x 3-1/2 (Fisher Scientific, NC9194790), and equilibrating overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... coupled to an Acclaim PepMap 100 column (2 cm x 75 μm, 3 μm particle size, Thermo Fisher Scientific) coupled in line with an EASY-Spray PepMap RSLC C18 reversed-phase column (50 cm x 75 μm ...
-
bioRxiv - Microbiology 2023Quote: ... tilt series were acquired at binning 2 on a Falcon 3 camera under the controls of Tomography software (ThermoFisher). For cryo-ET of the enrichment culture ...
-
bioRxiv - Cancer Biology 2023Quote: ... reagent at a 4:2:3 ratio of sgRNA/overexpression-construct: pVSVG: psPAX2 in Opti-MEM media (Life Technologies, Thermo Fisher Scientific Inc ...
-
bioRxiv - Cancer Biology 2023Quote: Mouse primary myoblasts were isolated from limb muscles of pups (2-3 days old) and cultured in Ham’s F-10 nutrient mixture (Invitrogen) with 20% FBS (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNAs were synthesized from 2 to 3 μg of total RNA using SuperScript IV and Oligo dT12-18 (Thermofisher) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by seeding of 2-3×106 cells onto T25 flasks (Thermo-Fisher Scientific; Cat. No. 12-556-009) coated with Matrigel ...
-
bioRxiv - Cell Biology 2023Quote: Mouse primary myoblasts were isolated from the limb muscles of 2-3 day-old pups and cultured in Ham’s F-10 nutrient mixture (Invitrogen) as described before.38 The culture medium was supplemented with 20% fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2023Quote: ... The peptides were first concentrated on a precolumn (PepMap100 C18 3 μm; 75 μm × 2 cm; Thermo Fisher Scientific) and then separated on an EASY-Spray column (ES903 ...