Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for 3 2 Methoxy phenoxymethyl piperidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... the PBS or virus dilution in PBS was aspirated and 3 ml of overlay consisting of 1:1 2 x DMEM (DMEM high glucose, no sodium bicarbonate buffer powder [Gibco # 12-100-046] in 500 mL of RNase-free water ...
-
bioRxiv - Neuroscience 2024Quote: Duplex of the MEF2C enhancer sequence containing a mutation site [5′-ATGTATTTTTCTGCAATAAGT-3′ (×2)] in human genomic DNA were synthesized (Invitrogen). Additionally ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were washed 3×2 minutes with DPBS before a permeabilization solution (0.1% Triton-X (Fisher Scientific, 9002-93-1) in DPBS ...
-
bioRxiv - Developmental Biology 2024Quote: ... Slides were then incubated for 1 hour in 2-3 drops per slide of HRP-conjugated streptavidin (Alexa Fluor 594 Tyramide Superboost Kit, Invitrogen), washed 3 times for 10 minutes each in 1x PBS ...
-
bioRxiv - Biochemistry 2024Quote: ... the final transfection mixture contained 3 μL of lipofectamine with 2 μg of total plasmid DNA in 200 μL OptiMEM (31985070, Gibco). The transfection mix was incubated for 20 min at room temperature before adding to seeded HEK cells (confluency ∼ 60-70% ...
-
bioRxiv - Bioengineering 2024Quote: ... 2.08 x 102 ng/cm2 of pDNA was mixed with the 2 μL p3000 reagent per μg DNA then combined with 3 μL/μg Lipofectamine 3000 (Invitrogen) and incubated for 15 minutes before adding over cells ...
-
bioRxiv - Biochemistry 2024Quote: ... the degree of labelling was compared to hydrolysed succinimidyl 3-(2-pyridyldithio)propionate (SPDP, 0.3 kDa vs. 2.7 kDa, ThermoFisher, UK, #21857). To appraise the percentage labelling the fluorescent signals from the chased samples were calibrated against F-MAL standards ...
-
bioRxiv - Bioengineering 2024Quote: ... and primers (Eurofins Scientific, France) at the specified melting temperature (Tm) (Table 2) using a QuantStudio 3 (Thermo Fisher Scientific) thermocycler ...
-
bioRxiv - Cell Biology 2024Quote: ... or BODIPY 558/568 C12 (C12) (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (ThermoFisher, #D3835) were complexed with fatty acid-free bovine serum albumin (BSA ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: ... FluoZin-3 (FluoZin™-3, AM, cell permeant, Thermo Fisher) was added at 1 mM ...
-
bioRxiv - Immunology 2020Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific). The activated beads were washed three times with 50 mM MES pH 5.0 and added to SARS-CoV-2 S protein which was diluted in 50 mM MES pH 5.0 ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Developmental Biology 2023Quote: ... mounting 3 dpf embryos in 3% methylcellulose (Thermo Scientific, 258111000). After imaging ...
-
bioRxiv - Immunology 2022Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific) and incubated for 30 min on a rotator at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... DiIC12(3) (1,1’-Didodecyl-3,3,3’,3’-Tetramethylindocarbocyanine Perchlorate) (Invitrogen, D383) was used ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3% FBS (Gibco), 1% MEM non-essential amino acids (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... DiOC2(3) (Invitrogen) was added to a final concentration of 30µM or DiSC3(5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3% FBS (Invitrogen), 20 ng ml−1 EGF (Peprotech ...
-
bioRxiv - Cell Biology 2020Quote: ... SUMO2/3 (Invitrogen), β-catenin (BD Transduction Laboratories) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3 (Applied Biosystems). We assembled forward and reverse reads using the Geneious (https://www.geneious.com ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% FBS (Gibco), 0.1mM MEM-NEAA (Gibco) ...
-
bioRxiv - Immunology 2024Quote: ... TOPRO-3 (Invitrogen) was added to the staining buffer at a dilution of 1:10000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... each sample was injected onto an EASY-Spray PepMap C18 column (75 mm id 3 25 cm, 2 mm particle size) (Thermo Scientific) and separated over a 2-h method ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were injected and concentrated on a trap column (PepMap100 C18, 3 µm, 100 Å, 75 µm i.d. x 2 cm, Thermo Scientific) equilibrated with 0.05% TFA ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peptides were injected onto an Acclaim PepMap100 C18 trap column (75 μm i.d., 2 cm long, 3 μm, 100 Å, Thermo Scientific) and further separated on an Acclaim PepMap100 C18 analytical column (75 μm i.d. ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were washed 2-3 times (200 rpm, 5 min at 4°C) in eBioscience™ Permeabilization buffer (250 µl/well) (Invitrogen) and resuspended in eBioscience™ Fixation/Permeabilization solution (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peptide mixtures were loaded on a C18 Acclaim PepMap100 trap-column (75 μm ID x 2 cm, 3 μm, 100Å, ThermoFisher Scientific) for 3.5 minutes at 5 μL/min with 2% ACN (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... 2-3 ml of logarithmically growing yeast cells in DOA media were added to a 35 mm FluoroDish (Fisher Scientific; 15199112) which had been pre-incubated at 30°C with Concanavalin A (Sigma Aldrich ...
-
bioRxiv - Biophysics 2021Quote: ... between 0.5-2 mg of individual histones were combined and dialyzed into 2 M NaCl (10 K MWCO, 3-12 mL Slide-A-Lyzer Dialysis Cassettes, ThermoFisher Scientific). After dialysis the histones in 2 M NaCl were concentrated to a volume of 1 mL and purified using an Superdex 200 column (GE Healthcare ...
-
bioRxiv - Systems Biology 2021Quote: ... Peptide mixtures were injected in 0.1% TFA on a C18 Acclaim PepMap100 trap-column (75 μm ID × 2 cm, 3 μm, 100Å, Thermo Fisher Scientific) for 3 min at 5 μL/min with 2% ACN ...
-
bioRxiv - Biochemistry 2020Quote: ... targeting the TLR3 gene (5’-CCUGAUGAUCUUCCCUCUAACAUAA-3’) and Stealth RNAi siRNA negative control med GC Duplex #2 were obtained from Thermo Fisher Scientific ...
-
Enzymatic RNA Biotinylation for Affinity Purification and Identification of RNA-protein InteractionsbioRxiv - Biochemistry 2020Quote: HeLa cell pellets (∼2×107) or MCF7 cell pellets (∼4×107) were lysed with 3 mL Mammalian Protein Extraction Reagent (Thermo Scientific), supplemented with 2X HALT protease inhibitor (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... we added a 1 mL of the following mixture to the culture media and incubated the cells at 25°C incubator for 1—3 hours: 5 μM Fura-2 AM (F-1201, Life Technologies), 250 μM probenecid (162-26112 ...
-
bioRxiv - Neuroscience 2020Quote: Cortical primary neurons from newborn triple neurexin-1/2/3 conditional KO mice13 were seeded on Matrigel-coated coverslips in a 24-well plate in MEM medium (ThermoFisher Scientific). On DIV2 ...
-
bioRxiv - Biophysics 2021Quote: α2-GFP or α2:β at 1:3 ratio was transfected into HEK293T cells on collagen coated glass bottom dishes using lipofectamine 3000 (Invitrogen) for expression of α2 GlyR or α2β GlyR ...
-
bioRxiv - Neuroscience 2021Quote: 2.5 μg peptides were pre-concentrated with a flow of 3 μL/min for 10 min using a C18 trap column (Acclaim PepMap100, 100 μm x 2 cm, Thermo Scientific) and then loaded onto a 50 cm long C18 column (75 μm ID ...
-
bioRxiv - Systems Biology 2020Quote: ... 1 μg peptides from each fraction was loaded onto trap column nanoViper 2 cm (3 μm C18 Aq) (Thermo Fisher Scientific). Peptide separation was carried out using EASY-Spray C18 analytical column (15 cm ...
-
bioRxiv - Plant Biology 2021Quote: ... The leaf discs were then counterstained by immersing them in 0.02 µg/mL DAPI in water for 3 min and rinsed 2× in water before imaging them using a fluorescence microscope (Evos, Thermo Fisher).
-
bioRxiv - Microbiology 2021Quote: ... The peptides were loaded onto an Acclaim PepMap 100 (ID 75μm x 2 cm, 3 μm, 100 Å) pre-column and separated on an EASY-Spray column (Thermo Scientific; ID 75 μm × 25 cm ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μL (60 pmol) of this mixture was added to 2 μL of TrueCut™ Cas9 v2 (∼60 pmol, ThermoFisher A36498), incubated at room temperature for 15 minutes to promote formation of Cas9:gRNA complexes ...
-
bioRxiv - Microbiology 2020Quote: ... The experimental setup was as follows: the peptide mixture was loaded onto a 75 μm × 2 cm precolumn (Acclaim PepMap 100, C18, 3 μm, Thermo Scientific) and eluted over 60 min using a 75 μm × 25 cm analytical column (Acclaim PepMap RSLC ...
-
bioRxiv - Cell Biology 2020Quote: ... The peptides were applied to a C18 column (Acclaim PepMap 100 pre-column, C18, 3 μm, 2 cm × 75 μm Nanoviper, Thermo Scientific) and subsequently separated using an analytical column (EASY-Spray column ...
-
bioRxiv - Cell Biology 2021Quote: ... were transiently transfected into 8 × 104 U2OS 2-6-3 cells in 4-well chamber slides using Lipofectamine 2000 reagent (Invitrogen, 11668019) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... Peptides were loaded onto an Acclaim PepMap 100 (75μm x 2 cm) C18 (3 μm, 100 Å) pre-column and separated on an EASY-Spray column (Thermo Scientific; ID 75μm x 50 cm ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 cm length) and EASY-Column (75 μm inner diameter, 10 cm length, 3 μm particle size, both Thermo Fisher Scientific). The separated peptides were analyzed using LTQ-Orbitrap Velos mass spectrometer (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... and then 1 μg of each peptide sample was loaded on a rap column (75 µm × 2 cm, 3 µm, C18, Thermo Fisher). The eluate was loaded onto a reversed-phase analytical column (50 µm × 250 mm ...
-
bioRxiv - Molecular Biology 2022Quote: ... The nTAP-MS peptides were applied on an Acclaim PepMap 100 C18 trap column (75 μm ID x 2 cm, 3 μm, Thermo Scientific) in 0.1% formic acid ...
-
bioRxiv - Developmental Biology 2022Quote: ... 10μM EdU was added for 2h to either day 2 or day 3 cultures and developed using the Click-IT EdU Alexa Fluor imaging kit (Life Technologies).