Labshake search
Citations for Thermo Fisher :
3301 - 3350 of 10000+ citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Samples were resuspended in water for detection on the Integron High Performance Ion Chromatography (HPIC) with suppressed conductivity detection (Thermo Fisher) as described previously69,70.
-
bioRxiv - Microbiology 2019Quote: ... PCR amplicons were cleaned and normalized using SequalPrep Plate Normalization Kit (Invitrogen, Carlsbad, CA, USA) and combined into four pools ...
-
bioRxiv - Microbiology 2022Quote: ... The amplicons were normalized using a SequalPrep™ Normalization Plate Kit (Thermo Fisher Scientific Inc.) and multiplexed.
-
bioRxiv - Microbiology 2019Quote: ... Plates were scraped and transformant plasmids isolated using the GeneJET plasmid purification kit (Thermo scientific).
-
bioRxiv - Microbiology 2022Quote: ... Sample normalization of the indexed amplicons was performed with the SequalPrep normalization plate kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... and successfully amplified libraries were normalized using SequalPrep™ Normalization Plate Kit (Thermo Fisher, USA). Normalized amplicons were then pooled and concentrated 20:1 using the 50K Dalton Millipore filters (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were cleaned and normalized using the SequalPrep Normalization Plate Kit (Invitrogen, Massachusetts, USA) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Human interleukin two (IL-2) Ready-SET Go! ELISA kit (eBioscience/Invitrogen) and Nunc MaxiSorp 96-well plates (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR was performed using 2× SYBR green qPCR kit (Thermo Fisher Scientific) with 95°C (15 sec) ...
-
bioRxiv - Immunology 2022Quote: ... T cell activation was assessed using mouse IL-2 ELISA kits (Invitrogen), with samples diluted 1:2 −1:20 for comparison to the standard curve ...
-
bioRxiv - Neuroscience 2022Quote: ... 2μg of cDNA prepared using a 2-step RT-PCR kit (Invitrogen) was used in 28 cycles of PCR with PlatinumTaq (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... with EGM-2 SingleQuots supplement kit (CC-4176, Lonza Clonetics, Fisher scientific). All experiments were performed using low-passage cells (passage 3-8) ...
-
bioRxiv - Neuroscience 2022Quote: ... Total RNA was extracted from the thalamus of 2 GAERS (10 and 90 days) and 2 NEC (10 and 90 days) male rats using a MagMax Kit (Ambion) and full length cDNAs generated using SuperScriptII with oligo-dT priming (Invitrogen) ...
-
bioRxiv - Immunology 2024Quote: ... fraction in MACS buffer (2% heat-inactivated FBS, 2% 0,1M EDTA in PBSO) using the CD8+ Dynabead isolation kit (Thermo Fisher) and BD IMag Cell Separation Magnet (BD Biosciences) ...
-
bioRxiv - Bioengineering 2023Quote: ... Cetuximab and Avelumab F(ab’)2 fragments were generated using the Pierce F(ab’)2 preparation kit (Thermo Fisher Scientific), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... and EGFP with 2:2:1 (total 0.5 µg / coverslip) using the Lipofectamine 3000 transfection reagent kit (Thermo Fisher Scientific). Transfected cells were identified by EGFP signals ...
-
bioRxiv - Immunology 2021Quote: Naïve B cells were resuspended in PBS at 5×106 cells/ml and labeled with 5 µM of CellTraceTM Violet (CTV) Cell proliferation Kit (C34557; Thermo Fisher Scientific) at 37°C for 20 minutes according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: RNA ligase-mediated rapid amplification of 5’ cDNA ends (RLM-5’ RACE) was conducted with a GeneRacer kit (Invitrogen, Carlsbad, CA, USA) to map the cleavage sites of target transcripts ...
-
bioRxiv - Biophysics 2022Quote: ... with unlabeled forward (5’-CTTGTCTGTAAGCGGATGCC) and reverse (5’-ACGCAAACCGCCTCTCC) primers and purified using a GeneJet PCR Cleanup kit (Thermo Scientific, Waltham, MA). From the forward primer the templates contained the T7A1 promoter with a transcription start site 128 bp ...
-
bioRxiv - Molecular Biology 2022Quote: ... was co-transfected with either pre-gRNA or gRNA expression plasmids (1 µg per 6-well) using Lipofectamine 3000 kit (5 µl Lipo 3000 and 5 µl P3000 reagents per 6-well; Thermo Fisher Scientific) according to the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cells were first transfected with the pcDNA3_CasRx-GFP plasmid (2.5 µg per 6-well) using Lipofectamine 3000 kit (5 µl Lipo 3000 and 5 µl P3000 reagents per 6-well; Thermo Fisher Scientific) according to the manufacturer’s guidelines ...
-
bioRxiv - Bioengineering 2022Quote: ... The 24-well plates with infected BHK-21 cells were overlaid with 1 ml of 0.8% methylcellulose in complete DMEM medium with 2% FBS and incubated for 5 days in a cell culture incubator (Thermo Fisher Scientific, 37°C and 5% CO2). Plaques were fixed and developed with staining reagent (1% crystal violet in 1:1 methanol/acetone solution ...
-
bioRxiv - Immunology 2022Quote: ... ELISA plates (96-well plates, Immunol4HBX, Thermo Fisher) were coated with a 50/50 mixture of His-Spy-RBD and RBD-Spy-His (2 μg/mL ...
-
bioRxiv - Bioengineering 2020Quote: 96-well plates (Nunc MediSorp plates; Thermo Scientific) were coated overnight at 4 °C with 50 ng/well of purified antigen (recombinant RSVF or designed immunogens ...
-
bioRxiv - Bioengineering 2020Quote: 96-well plates (Nunc MediSorp plates; Thermo Scientific) were coated overnight at 4 °C with 50 ng/well of purified antigen (recombinant RSVF or designed immunogens ...
-
bioRxiv - Immunology 2020Quote: ... Maxisorb 96-well plates (Nunc-immuno plates, Dutscher) were coated overnight at room temperature (RT ...
-
bioRxiv - Immunology 2022Quote: ... Nunc Immuno Plate MaxiSorp plates (Thermo Fisher Scientific) were coated either with 50 μg/ml NP4-BSA or 50 μg/ml NP26-BSA and incubated overnight at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: ... Custom PCR plates (TaqMan 96 well-plate, ThermoFisher) were used to assess mRNA expression on a QuantStudio 12K Flex Real-Time PCR System (ThermoFisher ...
-
bioRxiv - Biophysics 2024Quote: ... and 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydro (EDC, ThermoFisher). For BS3 crosslinking ...
-
bioRxiv - Plant Biology 2021Quote: ... 21 nt GAPDH-dsRNA (provided in the kit) was labeled with Cy™ 3 utilizing the Silencer™ siRNA Labeling kit (ThermoFisher) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2024Quote: ... Total RNA was extracted using Direct-zol RNA microprep kit and quantified using Qubit RNA High Sensitivity assay kit and Qubit 3 Fluorometer (Thermo Fisher Scientific). Purified RNA (50 ng ...
-
bioRxiv - Molecular Biology 2024Quote: RNA-protein interactions were detected using Pierce RNA 3’ End Desthiobiotinylation Kit and Pierce Magnetic RNA-Protein Pull-Down Kit (Thermo Scientific, #20163), according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... and Standard Control (5’ CCTCTTACCTCAGTTACAATTTATA 3’) MOs (GeneTools) were diluted in distilled water and co-injected with Cascade Blue labelled dextran (Molecular Probes) into one- to two-cell wild-type (Tübingen ...
-
bioRxiv - Neuroscience 2020Quote: ... The slides were then washed in 1X PBS 3 times for 5 minutes before being incubated with Hoechst 33342 (Thermo Fisher) for 5 minutes before being washed again and coverslipped with prolong diamond (Life Technologies) ...
-
bioRxiv - Neuroscience 2021Quote: ... we designed more than 2 pairs of PCR primers in the 5’ and 3’ untranslated regions and inserted all resulting PCR products into pCR-Blunt-TOPO vector (Thermo Fisher). The TOPO-transcript vectors of the same gene were sequenced and compared to verify that no error was introduced to the coding sequence during reverse transcription ...
-
bioRxiv - Molecular Biology 2021Quote: ... Both halves of MF filters and entire SF filters were transferred independently to 5 mL Eppendorf tubes and 3 mL of autoclaved PBS pH 7.4 (1X) (Gibco™, Thermo Fisher) was added ...
-
bioRxiv - Molecular Biology 2020Quote: ... We also sequentially removed the 5’ and 3’ viroid moieties from this latter plasmid via PCR with the phosphorylated primers (T4 polynucleotide kinase, Thermo Scientific) D3606 and D3285 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The MommeD43 mutation (A667E) was introduced by oligonucleotide-directed mutagenesis (5’ CTGTGCCCATTGAAAAGCTGGAT AGG; 3’ CCTATCCAGCTTTTCAATGGGCACAG) and ligated into the pFastBac Htb vector (Life Technologies). Bacmids were prepared using the Bac-to-Bac system ...
-
bioRxiv - Genomics 2020Quote: ... cells were washed 3 times in 1xPBS for 5 minutes at room temperature and mounting was done in ProLong Gold with DAPI (Invitrogen, P36935). Images were collected on a LSM800 confocal microscope (Zeiss ...
-
bioRxiv - Genomics 2020Quote: ... 1,000,000 wild-type (J1) mESCs were transfected with 1µg of each 5’ and 3’ sgRNA-Cas9-mCherry plasmids using Lipofectamine 2000 (Thermo Fisher Scientific). After 24hrs of transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1.5 μg of reporter plasmid and 15 ng of Cre-plasmid was mixed with 3 μL Lipofectamine LTX reagent (Invitrogen, #15338100), 1.5 μL PLUS reagent and 100 μL Opti-MEM following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... Frozen tissues (3 - 5 mm3, 0.1 - 0.3 g) were submerged in 10 ml of TRIZOL Reagent (Life Technologies, Carlsbad, CA, USA), an amount three times larger than that recommended by the supplier ...
-
bioRxiv - Molecular Biology 2019Quote: ... shCyb5r3 adenovirus was generated by cloning the effective shRNA sequence (5’-GATTGGAGACACCATTGAAT-3’) into the pEQU6-vector with LR Clonase II (ThermoFisher 11791100), then ligating to pAd-REP ...
-
bioRxiv - Immunology 2021Quote: ... Larvae were let to recover in E3 for 3 hours and 30 minutes and then incubated for 45 minutes in 5 µM CellROX® Deep Green Reagent (Invitrogen) solution diluted in E3 without methylene blue ...
-
bioRxiv - Biochemistry 2021Quote: Samples were reconstituted in 3% ACN/ 5% FA prior to LC-MS/MS analysis on a Fusion Lumos or Orbitrap Exploris 480 (Thermo Scientific). A pool of two IPs was injected twice as a technical replicate ...
-
bioRxiv - Microbiology 2020Quote: ... An amplicon was amplified encoding the S protein with a 19 amino acid truncation of the cytoplasmic tail using primers containing flanking 5’-KpnI and 3’-XhoI sites and cloned into pcDNA6 (Invitrogen, Inc.). To construct the ACE2 expression vector pLenti.ACE2-HA ...
-
bioRxiv - Biophysics 2021Quote: ... plus 1% penicillin/streptomycin in a humidified incubator at 37 °C and 5% CO2 and passaged every 3-4 days using 0.05% of Trypsin-EDTA (Thermo Fisher Scientific) to lift the cells from the culture dish ...
-
bioRxiv - Neuroscience 2020Quote: ... tissues were washed in PBS (3×5 min) and incubated with secondary antibodies conjugated to Alexa Fluor 488 (1:400; goat anti–rabbit; Life Technologies) or Alexa Fluor 594 (1:400 ...
-
bioRxiv - Microbiology 2021Quote: ... 3-5 µg of protein was subjected to nanoflow liquid chromatography on an EASY-nLC system (Thermo Fisher Scientific, Bremen, Germany) on-line coupled to an Q Exactive HF quadrupole orbitrap mass spectrometer (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2021Quote: ... Aliquots of the RNA preparations were subjected to RT with primer PI (5’-AGGCTTGCAAACGGAGTCTAA-3’) and RevertAid reverse transcriptase (Thermo Scientific). RT products were amplified by PCR with Thermus thermophilus DNA polymerase (Biotools ...