Labshake search
Citations for Thermo Fisher :
3251 - 3300 of 10000+ citations for rno mir 542 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... For real-time PCR analysis cDNA was synthesized with the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368813) and real-time qPCR was performed using either the PowerUp SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... and 2019-nCov CDC EUA Kit (Integrated DNA Technologies) with 7500 Fast Dx Real-Time PCR Instrument (Applied Biosystems).
-
bioRxiv - Microbiology 2022Quote: ... using qScript 1-Step SYBR Green qPCR kit (Quantabio) on a ViiA 7 Real-Time PCR System (Applied Biosystems); 16S rRNA was used for normalization ...
-
bioRxiv - Cell Biology 2022Quote: ... quantified using real-time PCR and the Qubit dsDNA HS Assay kit on a Qubit 2.0 fluorometer (Thermo Scientific). The quantified libraries were pooled in equimolar ratio and sequenced on a NovaSeq 6000 (Illumina).
-
bioRxiv - Developmental Biology 2023Quote: ... Real-time quantitative PCR (qPCR) was performed using a StepOne thermocycler with a Sybr green mix kit (Applied Biosystems). Primer sequences were chosen for Eln (forward ...
-
bioRxiv - Microbiology 2022Quote: ... RT-PCR was conducted using a SuperScript™ III One-Step RT-PCR kit (Invitrogen, Carlsbad, CA, USA) to amplify the extracted viral RNA (Qiagen) ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative RT-PCR was then performed with TaqMan RNA-to-Ct One-step RT-PCR kit (Applied Biosystems) using the following cycling conditions ...
-
bioRxiv - Immunology 2020Quote: ... RT-PCR was carried out using TaqMan® One-Step RT-PCR master mix reagents kit (Applied Biosystems) with HCV primers (sense S66 [ACGCAGAAAGCGTCTAGCCAT] and anti-sense A165 [TACTCACCGGTTCCGCAGA] ...
-
bioRxiv - Microbiology 2023Quote: ... RT–PCR was performed using a Superscript III One-Step RT-PCR kit (Thermo Fisher Scientific, CA, USA) and an ABI StepOnePlus PCR system (Applied Biosystems ...
-
bioRxiv - Plant Biology 2019Quote: Gene expression was studied by quantitative real-time PCR (StepOne plus, Applied Biosystems) using the Power SyBR Green master mix (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2019Quote: ... using a QuantStudio™ 12K Flex Real-Time PCR System (Thermo Fisher Scientific) to determine the expression levels of GAD1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... in a ViiA 7 or 7900 HT Real-Time PCR system (Applied Biosystems). Data analysis was performed using the RQ Manager (Applied Biosystem ...
-
bioRxiv - Cell Biology 2020Quote: ... in an Applied Biosystems 7500 Fast Real-time PCR System (Thermo Fisher Scientific). Relative mRNA levels of the indicated genes were calculated by the 2-DDCT method (Bulletin 5279 ...
-
bioRxiv - Immunology 2021Quote: ... qPCR was performed on the QuantStudio 3 Real-Time PCR System (Applied Biosystems) using SYBR Green ...
-
bioRxiv - Immunology 2021Quote: ... on the QuantStudio 5 or QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific). Relative transcript levels were normalized to TATA-binding protein (Tbp ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quantitative real-time PCR was performed using the SYBR Green system (Applied Biosystems) with primers listed in Supplemental Table 8 ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR reactions were performed using a StepOnePlus Real-Time PCR system (Applied Biosystems) and PowerUp SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... was used on the QuantStudio 6 Flex real-time PCR system (Applied Biosystems). Primers specific for miR-2-5p ...
-
bioRxiv - Microbiology 2020Quote: ... Reactions were performed on a QuantStudio 3 Real-Time PCR System (Thermo Fisher) with the amplification conditions as previously described (14).
-
bioRxiv - Developmental Biology 2021Quote: ... qPCR was done on QuantStudio 3 Real Time PCR Systems (Thermo Fisher Scientific) with the TaqMan gene expression Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... reactions were run on a ViiA 7 Real-Time PCR System (Applied Biosystems) using the following program ...
-
bioRxiv - Neuroscience 2021Quote: ... Complementary DNA was amplified on a ViiA7 Real-Time PCR system (Thermo Scientific) with POWRUP SYBR Green Master Mix (cat# 4368706Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR was done on the StepOnePlus Real-Time PCR System (ThermoFisher, Waltham, MA) using TaqMan Universal PCR Master Mix.
-
bioRxiv - Molecular Biology 2021Quote: Transcription was quantified using a StepOne Real-Time PCR System (Applied Biosystems, USA). The analyses were performed using the cycle threshold (Ct ...
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR was running using a 7500 Fast Real-time PCR system (Applied Biosystems). qPCR primer sequences can be found in the Table S5 ...
-
bioRxiv - Molecular Biology 2019Quote: ... on an ABI Prism ViiA 7 Real-Time PCR System (Thermo Fisher Scientific). Libraries were sequenced on a HiSeq4000 (Illumina).
-
Prom1 and Notch regulate ciliary length and dynamics in multiciliated cells of the airway epitheliumbioRxiv - Cell Biology 2022Quote: ... and a StepOnePlus™ Real-Time PCR System (Applied Biosystems, Foster City, CA). The following primers (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... The melting curve analysis (ViiA TM 7 Real-Time PCR system, Applied Biosystems) and size fractionation by agarose gel electrophoresis were used to confirm amplification of the expected products ...
-
bioRxiv - Immunology 2022Quote: ... Amplification was performed in a StepOne Plus Real time PCR system (Applied Biosystems). Finally ...
-
bioRxiv - Genomics 2020Quote: ... and Quantstudio™ 5 Real-time PCR System (Thermo Fisher Scientific, Waltham, MA) before multiplex pooling and sequencing in a 2×250 flow cell on the MiSeq platform (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative PCR was performed on a QuantStudio 12 Flex Real-Time (Applied Biosystems). A standard curve was generated for each human gene from untreated HeLa cells and for each mouse gene from untreated NIH3T3 cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... Threshold Ct values were calculated in StepOne real Time PCR system (Applied Biosystems) and normalized using the house keeping genes (elongation factor) ...
-
bioRxiv - Cancer Biology 2019Quote: ... qPCR was analyzed with the Viia 7 Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Developmental Biology 2019Quote: ... The real-time PCR with the mixture reagent SYBR Green (Thermo Fisher Scientific) was carried out on a real-time detection system (ABI7500) ...
-
bioRxiv - Cell Biology 2019Quote: ... and run in triplicates using StepOne Plus Real-Time PCR system (Applied Biosystems) (Liang et al. ...
-
bioRxiv - Genetics 2020Quote: ... Reactions were run on the StepOne Plus Real-Time PCR System (Applied Biosystems) or the QuantStudio 6 Flex (Thermo Fisher) ...
-
bioRxiv - Genetics 2020Quote: ... Reactions were run on the StepOne Plus Real-Time PCR System (Applied Biosystems) or the QuantStudio 6 Flex (Thermo Fisher) ...
-
bioRxiv - Immunology 2019Quote: ... Data was analyzed on a ViiA 7 Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Microbiology 2019Quote: ... Data were collected using a ViiA 7 Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Cell Biology 2019Quote: ... on a ViiA7™ Real-Time PCR System (Applied bio-systems, Life Technologies). Data was analysed using the 2(−ΔΔCT ...
-
bioRxiv - Immunology 2020Quote: ... using the Fast Real-Time PCR System 7500 (Applied Biosystems, Waltham, Massachusetts, USA). Primer sequences are shown in Supplementary Table 1 and the average CT values for each gene from three independent experiments are provided in Supplementary Table 2 ...
-
bioRxiv - Cell Biology 2019Quote: ... Reactions were run on QuantStudio 6 Flex Real-Time PCR system (Applied Biosystems, part of Life Technologies Corporation ...
-
bioRxiv - Biochemistry 2019Quote: ... reactions were run on a ViiA 7 Real-Time PCR System (Applied Biosystems) using the following program ...
-
bioRxiv - Cell Biology 2020Quote: ... TLDAs were executed on an ViiA 7 real-time PCR system (Applied Biosystems) with following cycling conditions ...
-
bioRxiv - Cell Biology 2020Quote: ... or real-time PCR probes and TaqMan Fast Advanced MasterMix (Thermo Fisher Scientific) on a Step One Plus real-time PCR system (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: ... Data were collected using a ViiA 7 Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Cancer Biology 2019Quote: ... Signals were detected by StepOnePlus real-time PCR system (Thermo Fisher Scientific, 4376600) with StepOne software ver2.2.2.
-
bioRxiv - Cell Biology 2019Quote: Quant-Studio 6 Flex Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA) and PrimeScript RT reagent kit with gDNA Eraser and SYBR Premix Ex Taq II (T1i RNase H Plus ...
-
bioRxiv - Molecular Biology 2019Quote: ... CT values were measured using the StepOnePlus Real-Time PCR System (ThermoFisher Scientific). Thresholding was performed according to the manufacturer’s instructions [58].
-
bioRxiv - Biochemistry 2019Quote: ... Fluorescent Intensity was measured by the StepOne Real-Time PCR System (Applied Biosystems). The temperature was raised from 25 °C to 99 °C with a velocity of 0.022 °C /sec ...