Labshake search
Citations for Thermo Fisher :
3201 - 3250 of 10000+ citations for Progesterone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: S phase status was monitored by measuring 5-ethynyl-2’-deoxyuridine (EdU) incorporation with the Click-iT™ Plus EdU Alexa Fluor 488 Flow Cytometry Assay Kit (ThermoFisher, C10632) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... the extracted DNA was directly Sanger sequenced from in 5’ and 3’ directions for each sample with the BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) according to the manufacturer’s protocol with the same primers as for the amplification (Prdm9ZnFA_Bal_R/Prdm9ZnFA_Bal_F) ...
-
bioRxiv - Microbiology 2019Quote: ... and antisense primer 3Vif (5-AGCTAGTGTCCATTCATTG-3) using a Superscript III single RT-PCR system with Platinum Taq DNA polymerase kit (Thermo Fisher Scientific) as per the manufacturers instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Three to six transformed colonies were cultured in 5 ml of LB medium and plasmids were subsequently purified with a GeneJET Plasmid Miniprep kit (Thermo Fisher Scientific). Purified plasmids were sequenced by Eurofins Genomics (Fig ...
-
bioRxiv - Molecular Biology 2021Quote: ... Northern blots were carried out using γ-32P 5’-end-labelled oligonucleotide probes or random primed probes prepared using α-ATP32 and the DECAprimeTM II labelling kit (ThermoFisher Scientific). Quantification of northern blots was performed using Storm 860 PhosphorImager (GE Healthcare ...
-
bioRxiv - Neuroscience 2021Quote: ... cRNA transcripts encoding human KCNQ1-5 were generated by in vitro transcription using the T7 polymerase mMessage mMachine kit (Thermo Fisher Scientific) or SP6 polymerase mMessage mMachine kit (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: RNA was isolated from WT and MafAS64F/+ islets (n=4 for males, n=5 for females) using the RNAqueous total RNA isolation kit (Ambion; Thermo Fisher), and then analyzed on an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Microbiology 2019Quote: ... All cells were maintained in a humidified incubator at 37°C and 5% CO2 and were found free of mycoplasma contamination on repeated testing with the MycoFluor Mycoplasma Detection Kit (Life Technologies, UK). MDCK II cells were treated as previously19 with the following modifications ...
-
bioRxiv - Genomics 2020Quote: ... the following components were added: 4 μl of 5× RT buffer (from the Maxima H Minus Reverse Transcriptase kit, Thermo Fisher Scientific), 1 μl of RNaseOUT™ (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2021Quote: ... and Heparin scaffold conditioned media groups (n=5) across 21 days (Days 0, 3, 7, 14, 21) using a RNAqueous™-Micro Total RNA Isolation Kit (ThermoFisher Scientific). RNA was then reverse transcribed to cDNA using a QuantiTect Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Synthetic Biology 2021Quote: Total RNA was isolated from 100 mg of fresh leaf tissue harvested at 5 dpi by using the GeneJET Plant RNA Purification Kit (Thermo Fisher Scientific). The RNA was treated with rDNase (Invitrogen ...
-
bioRxiv - Bioengineering 2022Quote: ... two rounds cRNA synthesis starting with 5 ng of total RNA were performed using the MessageAmp II aRNA amplification kit (Life Technologies, AM1751) and MessageAmp II-biotin enhanced aRNA amplification kit (Life Technologies ...
-
bioRxiv - Biochemistry 2020Quote: ... Sequencing primer 5’-AAGCTGGAGCTCCACCGCGG-3’ was annealed and sequencing was performed with the USB Sequenase Version 2.0 DNA sequencing kit (Thermo Fisher Scientific - 70770).
-
bioRxiv - Plant Biology 2021Quote: ... with CACC at 5’ end) was cloned in pENTR-D-TOPO vector using pENTRTM Directional TOPO® cloning kit (Invitrogen Inc. USA). This fragment was mobilized to pANDA vector (Miki and Shimamoto ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Then cDNA were produced from 5 μL of total RNA using RT Superscript III (RT Superscript III First Strand cDNA Synthesis Kit; Invitrogen, Life Technologies) and random hexamer primers (50 ng ...
-
bioRxiv - Neuroscience 2020Quote: Small RNA libraries were constructed from 50 ng of RNA extracted from brain homogenate or 5 µl of RNA from bdEVs using the Ion Total RNA-Seq Kit V2 (Life Technologies 4475936). Barcoding was performed with the indices from the Ion Xpress™ RNA-Seq Barcode 1-16 Kit (Life Technologies 4471250 ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were pulsed with 10µM 5-Ethynyl-2’deoxyuridine (EdU) for 2 hours following manufacturer’s instructions (Click-iT® EdU Alexa Fluor® Imaging Kit, Life Technologies). Cells were subsequently fixed and stained with Hoechst 33342 ...
-
bioRxiv - Cell Biology 2022Quote: ... QuantStudio™ 5 Real-Time PCR System (Applied bioscience) or Bio-Rad (CFX-maestro) using DyNAmo ColorFlash SYBR Green qPCR kit (Thermo Fisher Scientific). The transcript levels were quantified using 2-ΔΔ Ct (Livak and Schmittgen ...
-
bioRxiv - Microbiology 2020Quote: ... The gene fragments PpilA5-pilA6-pilA5 and PpilA5-pilA6-pilA5-pilA6 were amplified from WT chromosomal DNA with an SdaI recognition site at the 5’-end (P1-P3) and inserted into the pJET 1.2 vector (CloneJET PCR Cloning Kit, Thermo Scientific™, Germany). For the third construct ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was synthesized using 5 µg RNA as a template per reaction using the Superscript III First Strand Synthesis System Kit (Invitrogen,18080-051) and random hexamer primers using the following protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2.5 μg of RNA from each sample was used to synthesize cDNA with the SuperScript VILO cDNA Synthesis Kit (Life Technologies, #11755050). Quantification of each transcript of interest was performed in triplicates with SYBR Select Master Mix (Life Technologies ...
-
bioRxiv - Plant Biology 2022Quote: 5’-biotinylated RNA and unmodified RNA of Motif 3 (5’-AAAUCGCCGGAG-3’ 5’-Bio-AAAUCGCCGGAG-3’) were synthesized by Eurofins (Hamburg, Germany) and used for LightShift™ Chemiluminescent RNA EMSA Kit (Thermo Scientific). Total protein was extracted from LL and 10 min LL➔HL-treated plants using extraction buffer (25 mM Tris ...
-
bioRxiv - Molecular Biology 2019Quote: ... at 800 rpm for 5 minutes at room temperature and stained with LIVE/DEADTM viability/cytotoxicity kit (ThermoFisher Scientific, catalog number L3224) as the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... Protein pellets were dissolved in 200 uL 5% SDS solution and protein concentrations were determined using Pierce™ BCA Protein Assay Kit (ThermoFisher Scientific).
-
bioRxiv - Developmental Biology 2019Quote: ... Ovaries were then washed twice for 5 minutes each with 1XPBS + 3% BSA and then carried through the Click-iT Plus EdU Imaging Kit protocol (Thermo Fisher Scientific). Ovaries were imaged on a Nikon A1R-SI+ confocal microscope and >50 stage 10 chambers were examined for EdU foci in each genotype.
-
bioRxiv - Plant Biology 2020Quote: Young seedlings were incubated in 20 μM 5-ethynyl-2’-deoxyuridine (EdU) (Click-iT™ EdU Alexa Fluor™ 488 Flow Cytometry Assay Kit, ThermoFisher Scientific/Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cultured neurons were transfected with plasmids (1.5 μg of plasmid DNA per well) at 4 - 5 d in vitro (DIV) using a commercial calcium phosphate transfection kit (Thermo Fisher Scientific) as previously described21,24.
-
bioRxiv - Bioengineering 2020Quote: The IGFBP-derived NLS peptides (NLS-3 and NLS-5) were extracted from the bacteria using the B-Per 6xHis Fusion Protein Purification Kit (Thermo Scientific, USA), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: 10 ng total RNA containing 5 pM ath-miR-159a spike-in was reverse-transcribed using Taqman Advanced miRNA cDNA synthesis kit (Applied Biosystems #A28007) and miRNAs were detected using specific probes for ath-miR159a (478411_mir) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Three to six transformed colonies were cultured in 5 ml of LB medium and plasmids were subsequently purified with a GeneJET Plasmid Miniprep kit (Thermo Fisher Scientific). Purified plasmids were sequenced by Eurofins Genomics.
-
bioRxiv - Genetics 2020Quote: Proteins were extracted form 20 μL of ammonium bicarbonate resuspended fractions by adding 5 μL of lysis buffer (10% NP40, 2%SDS in PBS) and quantified by BCA protein assay kit (ThermoFisher Scientific, 23225).
-
bioRxiv - Immunology 2021Quote: ... RT-PCR was performed using OC43-nucleocapsid specific TaqMan primers and a probe 18 fluorescent- labelled with a 5’-FAM reporter dye and 3’-BHQ quencher (IDT) and AgPath-ID™ One-Step RT-PCR kit (AgPath AM1005, Applied Biosystems) on an ABI QuantStudio 3 platform (Thermo Fisher) ...
-
bioRxiv - Physiology 2020Quote: ... and lysed in a minimum of 5 µL Cells-to-CT buffer containing 1% DNAse I (Taqman Gene Expression Cells-to-CT Kit, Thermo Fisher Scientific), or a volume adjusted for a final cell concentration of ∼1000 cells/µL for 5 min at RT ...
-
bioRxiv - Physiology 2020Quote: ... as well as non-specific negative control oligonucleotides (5′-AAATGTACTGCGCGTGGAGAC-3′) were cloned into pcDNA6.2-GW/EmGFP-miR [“BLOCK-iT™ PolII miR RNAi Expression Vector Kit” (Invitrogen, Darmstadt, DEU). Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119) ...
-
bioRxiv - Bioengineering 2021Quote: ... These were then treated with 10 µM Ethidium Homodimer-1 and 5 uM Calcein AM from a Live/Dead Test Kit (Molecular Probes, Thermofisher Scientific) to a total volume of 250 uL PBS and incubated (37°C ...
-
bioRxiv - Bioengineering 2021Quote: ... S1-RBD and ACE2 recombinant proteins were expressed in Expi293 cells for 5 days following transient transfection using Expifectamine 293 Transfection Kit (Thermo Fisher Scientific). Cell cultures were centrifuged at 4500g for 40 min ...
-
bioRxiv - Neuroscience 2022Quote: ... except that they also received 2 injections of 10 mg/kg 5-ethynyl-2’-deoxyuridine (EdU) from the Click-iT EdU Alexa Fluor 647 imaging kit (Invitrogen, Carlsbad, CA), the day after DOX injection (4 DPN ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2-cell stage embryos were transferred to new KSOM containing 1 mM 5-ethynyl uridine (EU, from Click-iT RNA Alexa Fluor 488 Imaging Kit, Thermo Fisher Scientific) and cultured for 1h at 37°C with 5% CO2 ...
-
bioRxiv - Bioengineering 2022Quote: ... 2.2 mM LAP was added to half of the samples and 10 µM 5-ethynyl-2’-deoxyuridine (EdU) solution from a Click-iT Plus EdU Cell Proliferation Kit (cat. no. C10637; Invitrogen, Waltham, MA) was added to the other half according to manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... RT was performed with 5-10 μg of DNase-treated total RNA using the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) and RT reactions were carried out according to the manufacturer’s instructions with random primers ...
-
bioRxiv - Cancer Biology 2024Quote: ... Substrate-induced changes of cell proliferation were analyzed after 5 days of culture using the Click-iT EdU Alexa Fluor 647 Imaging Kit (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: Approximately 5 μg of total purified RNA were then treated with the Turbo DNA-free kit (Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: Aliquots were taken for flow cytometry measurement with SYBR Green I and MitoProbe DiIC1(5) kit (both Thermo Fisher Scientific, Waltham, MA). Primed samples were compared to non-primed counterparts for reduction in growth ...
-
bioRxiv - Neuroscience 2024Quote: ... the PCR products from using the primer DBH-WT-F and DBH-3’junc-R 5’- TCTGAAGAATAGCTTCTCACAAgagctcag were subcloned into the pCR Blunt II TOPO vector (Zero Blunt TOPO PCR Cloning Kit, Thermo Fisher Scientific) and sequenced using M13-Foward and M13-Reverse primers.
-
bioRxiv - Microbiology 2024Quote: ... and 1492R (5’-TACGGYTACCTTGTTACGACTT-3’) [29–31] with the Invitrogen Platinum II Taq Hot-Start DNA Polymerase kit (Cat. No. 14966001, Invitrogen, Waltham, MA). The 16S rRNA gene amplicons were sequenced by GENEWIZ (Azenta Life Sciences ...
-
bioRxiv - Cancer Biology 2024Quote: ... qRT-PCR was performed using DyNAmo ColorFlash SYBR Green qPCR Kit in the ABI Quant Studio 5 Sequence Detection System (Life Technologies, USA). The expression of the genes of interest was analyzed by the ΔΔCt method using ATP5G rRNA and GAPDH as internal control genes ...
-
bioRxiv - Microbiology 2023Quote: ... Positive transformants were inoculated in 5 mL liquid LB medium (omitting the Bacto agar) and plasmids were isolated using a GeneJET Plasmid Miniprep Kit (Thermo Fisher Scientific). Correct plasmid structure was confirmed using restriction analysis using the FastDigest KpnI enzyme (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... 5’-/FAM/TCAAGGAACAACATTGCCAA/TAMRA/-3’) were examined by real-time RT-PCR using High Capacity cDNA Reverse Transcription kit (Applied Biosystems, 4368813) and AriaMX (Agilent ...
-
bioRxiv - Cell Biology 2023Quote: ... The library is quantified through qPCR (Invitrogen™ Collibri™ Library Quantification Kit; QuantStudio™ 5 Real Time PCR Systems, APPLIED BIOSYSTEMS).
-
bioRxiv - Developmental Biology 2023Quote: ... R: 5′- AAAGCACCGACTCGGTGCCAC-3′) and used as a template for in vitro transcription using MEGAshortscript T7 kit (Ambion/Thermo Fisher Scientific AM1354). 2ng gRNA was injected together with 1.9nM Cas9 protein (New England Biolabs M0386T ...