Labshake search
Citations for Thermo Fisher :
3201 - 3250 of 10000+ citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... were maintained in cDMEM (100 U/ml penicillin/streptomycin, 100 μg/ml streptomycin, 2 mM L-glutamine, 10 % FBS, 3.7 g NaH2CO3/L, pH7.2; ThermoFisher Scientific) and cRPMI-1640 (100 U/ml penicillin/streptomycin and 10 % FBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... U2OS and HEK-239T cells were grown in DMEM containing 2.5 mM L-glutamine and 4.5 g l-1 D-glucose (Life Technologies). H1299 cells were grown in RPMI 1640 medium containing 2.5 mM L-glutamine.
-
bioRxiv - Biophysics 2020Quote: ... supplemented with 10% (vol/vol) Fetal Clone III (HyClone) and 2 mM GlutaMAX (L-alanyl-L-glutamine dipeptide in 0.85% NaCl, Gibco). Cells are checked annually for mycoplasma contamination and were authenticated through mass spectrometry (the protein sequences exactly match those in the African green monkey genome) ...
-
bioRxiv - Genomics 2019Quote: ... Intact 12 day-old seedlings were transferred in 8 mL of 1% liquid MS media (4.4 g/L MS salts mixture, 10 g/L D-sucrose) in 6 well-plates (Nunc) and allowed to acclimate for 48 hours with mild agitation (130 rpm).
-
bioRxiv - Biochemistry 2022Quote: ... cells were cultured in high-glucose Dulbecco’s Modified Eagle’s Medium (DMEM) containing L-glutamine and 110 mg/L sodium pyruvate (Gibco, ThermoFisher Scientific) supplemented with 10% tetracycline-free fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2022Quote: ... the growth media was replaced with high-glucose Dulbecco’s modified Eagle’s medium containing L-glutamine and 110 mg/L sodium pyruvate (Gibco, ThermoFisher Scientific) and 10% tetracycline-free fetal bovine serum (Wisent ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were maintained in a humidified 37° C incubator with 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM, MilliporeSigma) supplemented with 2 mM L-Glutamine (L-Glu, Gibco), 0.1 mM non-essential amino acids (NEAA ...
-
bioRxiv - Bioengineering 2022Quote: ... Imaging medium consisted of phenol-free DMEM (4.5 g l-1 glucose, L-glutamine, and 25 mM HEPES, 21063-029, Invitrogen) supplemented with 10% FBS ...
-
bioRxiv - Microbiology 2022Quote: ... Vero E6 TMPRSS2 cells were maintained in DMEM with 4.5 g/L glucose and 2 mM L-glutamine (Gibco), 10% heat-inactivated FBS (R&D Systems) ...
-
bioRxiv - Plant Biology 2022Quote: ... 50 L loosened peat and 25 L coarse vermiculite) and maintained in a growth chamber (Invitrogen, Clayton, Missouri, USA) under a light period of 16-hour at 25 °C and relative humidity of 60-80% ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were maintained in a humidified 37° C incubator with 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM, MilliporeSigma) supplemented with 2 mM L-Glutamine (L-Glu, Gibco), 0.1 mM non-essential amino acids (NEAA ...
-
bioRxiv - Immunology 2023Quote: ... The Aedes albopictus mosquito-derived cell line C6/36 was maintained at 28°C in a BOD in Leibovitz’s L-15 medium (L-15) (Gibco) supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... Live imaging medium for cell lines consisted of phenol red-free DMEM (4.5 g l-1 glucose, L-glutamine, and 25 mM HEPES, #21063-029, Invitrogen) supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2023Quote: Kidneys were harvested and transferred to MEM with Earle’s Salts (with 2.2 g/l NaHCO3, without L-Glutamine) medium (Biochrom) supplemented with 10% FCS (Life Technologies), 1x Non-Essential Amino Acids (NEAA ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mixture was resuspended in 1 ml of DMEM before adding the mixture to a 6-well plate containing 2 ml of DMEM with 4.5 g/L D-Glucose and L-Glutamine (Gibco) supplemented with supplemented 10% FBS ...
-
bioRxiv - Bioengineering 2023Quote: MCF7 cells were cultured in full DMEM medium (Dulbecco’s modified Eagle Medium 1x with added 4.5 g/L D-glucose, L-glutamine and pyruvate, from Thermo Fisher), supplemented with 10% fetal bovine serum ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell suspension was combined with adipocyte culture medium (DMEM/F12 supplemented with 2.5 mM L-Alanyl-L-Glutamine, 10% fetal bovine serum [GeminiBio], 100 U ml-1 Penicillin [Gibco] ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 10% (vol/vol) Fetal Clone III (HyClone) and 2 mM GlutaMAX (L-alanyl-L-glutamine dipeptide in 0.85% NaCl, Gibco). hTERT-RPE1 cells (female Homo sapiens retinal pigment epithelium ...
-
bioRxiv - Cancer Biology 2024Quote: ... containing 4.5g/l Glucose with L-Gln and Sodium Pyruvate supplemented with 10% (v/v) fetal bovine serum (FBS; Gibco), Gluta-MaxTM-1 (Gibco) ...
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time PCR targeting PTPRZ1 (5’-ACTCTGAGAAGCAGAGGAG-3’ and 5’-CTGTTGTCTGTAGTATCCATTAG-3’) or GAPDH (5’-TCAAGGCTGAGAACGGGAAG-3’ and 5’-CGCCCCACTTGATTTTGGAG-3’) was performed with Power SYBR™ Green PCR Master Mix (Applied Biosystems 4367659) in three technical replicates.
-
Direct analysis of ribosome targeting illuminates thousand-fold regulation of translation initiationbioRxiv - Molecular Biology 2020Quote: ... and 3′ biotinylated using the Pierce RNA 3′end biotinylation kit (Thermo Scientific 20160).
-
bioRxiv - Molecular Biology 2021Quote: ... counted and reseeded in 3 mL A medium (1:3 mix DMEM/F12 (Gibco) and Neurobasal (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2019Quote: 3’-tRNAs biotinylation was adapted from Pierce RNA 3’-End Biotinylation Kit (Thermo Fisher). Deacylated tRNAs were denaturated in 25% DMSO at 85°C for 5 minutes and directly chilled on ice ...
-
bioRxiv - Neuroscience 2019Quote: ... NIM was exchanged for “3:1 medium” containing 3 parts DMEM (Gibco, #10569‒010) per 1 part F12 medium (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μl were sampled on a 3 well Diagnostika slides (X1XER303B) from Thermo scientific for observation on an Zeiss LSM710 confocal microscope equipped with a Plan-Apochromat 63×/1.4 Oil objective and 405 nm and 488 nm lasers ...
-
bioRxiv - Microbiology 2023Quote: ... 3′RNA-seq libraries were analyzed on a Qubit 3 Fluorometer (Thermo Fisher Scientific) and an Agilent 4200 TapeStation System prior to paired- end sequencing using the HiSeq 2500 system (Illumina).
-
bioRxiv - Neuroscience 2024Quote: ... wells were treated with Caspase-3/7 (CellEvent™ Caspase-3/7 Green, Invitrogen) 1:1000 in treatment media ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 μg DNA and 3 μL Lipofectamine in 300 μl Optimem (Thermofisher Scientific, USA) were used per well containing 700 μl DMEM ...
-
bioRxiv - Bioengineering 2023Quote: ... and EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... sense 5’-CUACAAAGCUGAUGAAGAC-3’ and antisense 5’-GUCUUCAUCAGCUUUGUAG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 mg of solid red DiI (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate, Molecular Probes) dissolved in methylene chloride were mixed with 50 mg of tungsten beads (1.3 microns in diameter ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Immunology 2021Quote: ... 3 μM Hoechst (Life Technologies) was added to each well to stain nuclei for cell counting ...
-
bioRxiv - Immunology 2021Quote: ... 3 μM Hoechst (Life Technologies) was added to each well to stain nuclei for cell counting ...
-
bioRxiv - Genomics 2021Quote: ... 3 mL (Thermo Fisher Scientific) overnight at 4°C ...
-
bioRxiv - Genomics 2020Quote: ... 3 washes 5x SSCT (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 washes 5x SSCT (ThermoFisher Scientific 15557044 ...
-
bioRxiv - Biochemistry 2019Quote: ... 50 × 3 mm (Thermo Scientific). The mobile phase consisted of 100 mM ammonium carbonate (A ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3 mM glutamine (Life Technologies), 10% dialyzed fetal bovine serum (dFBS ...
-
bioRxiv - Developmental Biology 2019Quote: ... and toto-3 (Life Technologies) were used after primary antibody incubation.
-
bioRxiv - Immunology 2021Quote: ... supplemented with 3% FBS (Gibco) and 100 U/mL penicillin-streptomycin (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved-caspase-3 (9H19L2-Invitrogen); TH (AB152-Merck Millipore) ...
-
bioRxiv - Bioengineering 2020Quote: ... SP-DiOC18(3) (ThermoFisher Scientific) for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: sucrose (Fisher Scientific #S5-3), cellobiose [D-(+)-cellobiose ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM NaOH (Fisher Scientific) in neurobasal medium] and centrifugation at 800 × g for 5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... The QuantStudio 3 system (Thermofisher) was used for reactions under the following conditions ...
-
bioRxiv - Systems Biology 2020Quote: ... and 3 μl RNAiMAX (Invitrogen). For every gene ...
-
bioRxiv - Microbiology 2020Quote: ... using a QuantStudio 3 (ThermoFisher). KiCqStart SYBR green primers for qRT-PCR (Sigma-Aldrich ...