Labshake search
Citations for Thermo Fisher :
3151 - 3200 of 10000+ citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... 2 mM L-glutamine (Gibco, 25030-024), 1 mM sodium pyruvate (Gibco ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 1% L-Glutamine (25030-024, Gibco) in a 24-well plate (3524 ...
-
bioRxiv - Microbiology 2024Quote: ... 2 mM L-glutamine (GlutaMAX supplement; ThermoFisher), 20 U/mL IL-2 (AIDS Reagent Program ...
-
bioRxiv - Neuroscience 2024Quote: ... 1% L-glutamine (Life technologies 25030-081), 1% penicillin-streptomycin (Life technologies 15070-063) ...
-
bioRxiv - Neuroscience 2024Quote: ... 1% L-glutamine (Life Technologies, 25030-081), 4 mg/mL DNAase (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... 1% L-glutamine (Life technologies 25030-081), 1% penicillin-streptomycin (Life technologies 15070-063) ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with L-glutamine (#25030024 Gibco Thermofisher), and 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1× penicillin/streptomycin/l-glutamine (Gibco, 10378), 50 μM β-mercaptoethanol (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... L-glutamine (2mM, Cat# 25030-081; Gibco), triiodothyronine (T3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM L-glutamine (ThermoFisher, #25030–024), 100 μM 2-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM L-glutamine (Gibco #25030–024), sodium pyruvate (Sigma #S8636-100ML) ...
-
bioRxiv - Neuroscience 2024Quote: ... L-glutamine (2mM, Cat# 25030-081; Gibco), triiodothyronine (T3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM L-glutamine (Gibco #25030–024), 2 mM sodium pyruvate (Sigma #S8636-100ML) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and L-glutamine (2 mM, Gibco #25030081). To knockout the ADPRS gene ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM L-glutamine (Life Technologies #25030024) and 100 units/ml penicillin-streptomycin solution (Life Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mM L-glutamine (Gibco, 25030–024), and 1% penicillin/streptomycin (BioConcept ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mM L-glutamine (Gibco, 25030–024), and 1% penicillin/streptomycin (BioConcept ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mM L-glutamine (Gibco, 25030–024), and 1% penicillin/streptomycin (BioConcept ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2.2 mM L-Glutamine (Thermo Fisher – 25030081), 0.5x B27 (Invitrogen – 17504044) ...
-
bioRxiv - Genomics 2024Quote: ... + 1% L-Glutamine (Gibco catalogue number 25030081)) ...
-
bioRxiv - Neuroscience 2024Quote: ... 3g/L D-glucose (Thermo Fisher, A2494001), 1% N2 supplement-B (Stemcell Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.29 mg/mL L-glutamine (Gibco). The HeLa-JVM strain originally was obtained from the laboratory of Dr ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with L-glutamine (#25030024 Gibco Thermofisher), and 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Bioengineering 2023Quote: ... 1-ethyl-3-(3-dimethyl-aminopropyl) carbodiimide (EDC; 22980) was purchased from Thermofisher Scientific (MA) ...
-
bioRxiv - Microbiology 2020Quote: ... COL1A1 (5’-CGAAGACATCCCACCAATC-3’ and 5’-ATCACGTCATCGCACAACA-3’), ALP (5’-TCACTCTCCGAGATGGTGGT-3’ and 5’-GTGCCCGTGGTCAATTCT-3’) (IDT, Coralville, USA) and viral non-structural (nsP1) gene (Applied Biosystems, USA) (5’-GGGCTATTCTCTAAACCGTTGGT-3’ and 5’-CTCCCGGCCTATTATCCCAAT-3’ ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Bruner and Siliciano, 2018), env (Forward: 5’-AGTGGTGCAGAGAGAAAAAAGAGC-3’, Reverse: 5’-GTCTGGCCTGTACCGTCAGC-3’, Probe: 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB) (Thermo Fisher Scientific) (Bruner et al. ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Palmer et al., 2003) and pol (Forward: 5’-GCACTTTAAATTTTCCCATTAGTCCTA-3’, Reverse: 5’-CAAATTTCTACTAATGCTTTTATTTTTTC-3’, Probe: 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB) (Thermo Fisher Scientific) (Schmid et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Cell Biology 2020Quote: HEK293 and HEK293T cells were obtained from ATCC and grown at 37°C/5% CO2 in Dulbecco’s Modified Eagle Medium (4.5 g/L glucose and L-glutamine, no sodium pyruvate) from Thermo Fisher Scientific (Cat #11965118 ...
-
bioRxiv - Molecular Biology 2020Quote: ... pyruvate DMEM (4.5 g/L D-glucose, 110 mg/L sodium pyruvate; Gibco™ Thermo Fisher Scientific, Waltham, Massachusetts) supplemented with 10% heat inactivated FBS (Gibco™ Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... culture media was removed from cells and replaced with 50μl imaging media (L-15 media without Phenol Red containing L-glutamine (Gibco), 1% FBS and 10μM 9-cis retinal) ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 10% (vol/vol) Fetal Clone III (HyClone) and 2 mM GlutaMAX (L-alanyl-L-glutamine dipeptide in 0.85% NaCl, Gibco). Cells are checked annually for mycoplasma contamination and were authenticated through mass spectrometry (the protein sequences exactly match those in the African green monkey genome) ...
-
bioRxiv - Microbiology 2020Quote: ... and resuspended in fresh DMEM-10 (Gibco DMEM #11995-065 with 4.5 g/L D-Glucose and 110 mg/L Sodium Pyruvate, 10% Fetal Bovine Serum [HyClone], 1% HEPES [Gibco 1M 15630-080] ...
-
bioRxiv - Bioengineering 2022Quote: ... were cultured in 24-well culture plates in DMEM culture media (4,5 g/l glucose, L-Glutamine) supplemented with 10% fetal calf serum (Gibco) and 1% penicillin-streptomycin (Gibco) ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 10% (vol/vol) Fetal Clone III (HyClone) and 2 mM GlutaMAX (L-alanyl-L-glutamine dipeptide in 0.85% NaCl, Gibco). COS-7 cells were transfected using TransIT-LT1 transfection reagent (Mirus) ...
-
bioRxiv - Bioengineering 2022Quote: ... hADSCs were plated in 75 cm2 tissue culture treated flasks at a density of ~5000 cells/cm2 in growth media consisting of DMEM/F12 with L-Glutamine and 2.493 g/L sodium biocarbonate (Gibco) supplemented with 10 % fetal bovine serum (Wisent Bioproducts ...
-
bioRxiv - Biophysics 2022Quote: ... The PDMS chamber was perfused with L-15 cell culture medium (Leibovitz’s L-15 Medium, Gibco™, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... except they were plated and maintained using media that consisted of 1x DMEM (+4.5g/L D-glucose and L-Glutamine, Gibco), Pen-strep and 10% FBS ...
-
bioRxiv - Microbiology 2021Quote: ... were cultivated in Dulbecco Modified Eagle medium containing 4500 mg/L high glucose (1X) with 4.0 nM L-glutamine without sodium pyruvate (Gibco), and supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 10% (vol/vol) Fetal Clone III (HyClone) and 2 mM GlutaMAX (L-alanyl-L-glutamine dipeptide in 0.85% NaCl, Gibco). Cells are checked annually for mycoplasma contamination and were authenticated through mass spectrometry (the protein sequences exactly match those in the African green monkey genome) ...
-
bioRxiv - Biophysics 2019Quote: ... on reverse-phase columns (trapping column: particle size 3μm, C18, L=20mm; analytical column: particle size <2μm, C18, L=50cm; PepMap, Dionex/Thermo Fisher). Peptides were eluted in gradients of water (buffer A ...
-
bioRxiv - Genetics 2019Quote: ... from 3 independent subjects were obtained from the bone marrow of children undergoing osteotomy and cultured in growth medium which consisted of: DMEM containing L-Glutamine (61965-059) and 4.5 g/L Glucose (Gibco), with the addition of 10 % hyclone (SH30070.03) ...
-
bioRxiv - Biochemistry 2019Quote: ... and then incubated in 25ml of pre-warmed Dulbecco modified Eagle medium (4.5 g/L glucose with L-glutamine) containing 2 mg/mL collagenase (Invitrogen) in 50 ml tubes ...
-
bioRxiv - Plant Biology 2019Quote: ... Rh (10 µg L-1) and Ir (5 µg L-1) in 2% trace analysis grade (Fisher Scientific, UK) HNO3 ...
-
bioRxiv - Pathology 2020Quote: ... Transfection with SMARTpool siRNAs targeting Nck1 (L-006354) and Nck2 (L-019547; IDT) was performed using Lipofectamine 3000 (Invitrogen) according to the manufacture’s recommendations ...