Labshake search
Citations for Thermo Fisher :
2951 - 3000 of 10000+ citations for Progesterone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... followed by three washes in 1% BSA and incubation with TMB-ELISA substrate (Thermo Fisher Scientific, Cat. no. 34028) until the light blue color appeared ...
-
bioRxiv - Biochemistry 2021Quote: ... Binding was visualized through the addition of 50 µL 1-Step™ Ultra TMB-ELISA Substrate Solution (ThermoFisher, #34028), incubated in the above plate shaker for approximately 5 minutes ...
-
bioRxiv - Neuroscience 2022Quote: Serum samples from dams were analyzed via enzyme linked immunosorbent assay (ELISA) for IL6 and TNFα (Thermo Fisher Scientific) following manufacturer’s recommendations.
-
bioRxiv - Immunology 2022Quote: ... OSP and CT ELISAs were then blocked with warm 200 µl/well of R10 media (RPMI + L-Glutamate (Gibco), 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2019Quote: Serum IL-6 and IL-17A concentrations were assessed by ELISA according to the manufacturer’s instructions (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2020Quote: The concentration of cytokines in the 24h and 48h supernatants from the T57 T cell activation assay was measured by ELISA according to the manufacturer’s instructions (IFNγ: Invitrogen eBioscience, cat#88731477, IL-2: Invitrogen eBioscience ...
-
bioRxiv - Immunology 2020Quote: The concentration of cytokines in the 24h and 48h supernatants from the T57 T cell activation assay was measured by ELISA according to the manufacturer’s instructions (IFNγ: Invitrogen eBioscience ...
-
bioRxiv - Microbiology 2019Quote: ... After 4 washes with PBS 0.01% v/v Tween-20 and 2 washes with ELISA Light washing buffer (ThermoFisher), CSPD substrate with Sapphire II enhancer (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... The color reaction was started by adding 100 μL of One-step Ultra TMB ELISA substrate (Thermo Scientific #34028) was added to each well (100 μL) ...
-
bioRxiv - Physiology 2021Quote: ... slgA concentrations in saliva were measured using the ready-set-go ELISA system for human IgA (Affymetrix: eBioscience, USA) with a sample dilution of 1:7500 at the University Hospital RWTH Aachen (SI ...
-
bioRxiv - Immunology 2022Quote: ... A volume of 25 μL/well of 1-step Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific, cat. # PI34029) was added to the plates and incubated for 5 to 10 min at RT ...
-
bioRxiv - Immunology 2022Quote: ... Supernatants were collected for cytokine profiling by quantitative ELISA for IFNγ and IL-17A as per manufacturer’s instructions (Invitrogen). Prior to flow cytometric analysis for cytokine production ...
-
bioRxiv - Pathology 2023Quote: ... CCL2 levels were measured in conditioned media by ELISA (Invitrogen, cat nos. 88-7391-88 and 88-7399-88).
-
bioRxiv - Cell Biology 2023Quote: Human ApoE protein was quantified using the Invitrogen Human ApoE ELISA following the manufacturers guidelines (Invitrogen. Cat no. EHAPOE).
-
bioRxiv - Biochemistry 2023Quote: ... followed by the development of signal by treating cells with 200 μl TMB-ELISA (Thermo Scientific, Cat no. 34028) until the light blue colour appeared ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Incubation in prehybridization buffer (5× sodium saline citrate buffer [SSC], 5× Denhardt’s solution [ThermoFisher Scientific] ...
-
bioRxiv - Biophysics 2019Quote: ... 5 μL of 5 mg/mL streptavidin-labeled with Alexa Fluor 488 (ThermoFisher Sci.) was added for 30 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: Oligonucleotides ssDNASel25 (5’GGACAGGAAUUAAUAGUAGCUGUCC3’) and FITC(5’)-ssDNASel25 oligonucleotides were obtained from Invitrogen (USA), Cy5-DNA (5’ Cy5-AAACTATTATTACTCATTTTCCGCCAGCAGTCAACTTCGATTTAATTCGTAAACAGATCT3’ ...
-
bioRxiv - Bioengineering 2022Quote: ... 5% CO2 and 5% O2 in Essential 8 medium (Thermo Fisher Scientific, Waltham, MA) on Matrigel- (BioStrategy ...
-
bioRxiv - Biochemistry 2022Quote: 5 μM purified PWWP domain was incubated with 5× SYPRO Orange (Thermo Fisher Scientific) in assay buffer (20 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2022Quote: ... stained with 5 μM DRAQ5 (Thermo Scientific, nuclear dye, 5 minutes at 37°C), fixed in 4% paraformaldehyde for 20 minutes ...
-
bioRxiv - Biochemistry 2022Quote: 5 μg of purified protein was mixed with 5× SYPRO orange (Thermo Fisher Scientific) in 20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Immunology 2021Quote: ... and 5’ Rapid amplification of complementary DNA (cDNA) ends (5’RACE, Invitrogen, 18374-058) method as described previously20,21 ...
-
bioRxiv - Immunology 2021Quote: ... 5 ng/mL IL-1β and 5 ng/mL IL-23 from Invitrogen (14823163) (Th17.1s ...
-
bioRxiv - Molecular Biology 2023Quote: ... pH 7.0) and 2 µg anti-5-methylcytosine (5-mC) antibody (Thermo Fisher, 33D3), and incubated at 4°C overnight with rotation ...
-
bioRxiv - Cell Biology 2023Quote: ... equipped with a PEPMAP100 C18 5 µm 0.3 × 5 mm trap (Thermo Fisher Scientific) and an HSS-T3 C18 1.8 μm ...
-
bioRxiv - Cell Biology 2023Quote: ... sense 5’-CUACAAAGCUGAUGAAGAC-3’ and antisense 5’-GUCUUCAUCAGCUUUGUAG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... RPMI with 5% fetal bovine serum and 5 μM Lysotracker deep red (ThermoFisher Scientific) was used following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Microbiology 2024Quote: ... Nuclei were stained for 5 minutes in 5 μg/ml Hoechst 33258 dye (Thermofisher), and washed twice more in 1x PBS ...
-
bioRxiv - Pathology 2022Quote: RNA extractions of swab material were performed in 96-well plates using Mag Max-96 AI/ND Viral RNA Isolation Kit (Applied Biosystems, Foster City, California) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... 25 µl from prepared samples were added to one well of 96 well plate and Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific, 23225) manual was followed to measure the protein content ...
-
bioRxiv - Microbiology 2023Quote: ... then 50 μl of sample or standard was added per well (in duplicate) with premixed beads in a 96-well plate according to the manufacturer instructions (ThermoFisher Procartaplex Human Simplex kit). The plate was incubated overnight on a shaker at 4°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Ovarian cell suspensions were then seeded in 96-well V-bottom plates and incubated with LIVE/DEAD™ Fixable Blue Dead Cell Stain Kit (Invitrogen, L34962, 1:2000) and Fc Block (BioLegend ...
-
bioRxiv - Biophysics 2022Quote: ... 30,000 cells were seeded into a 24-well plate (NuncMicroWell Plates with Nunclon; Thermo Fisher Scientific, Waltham, MA, USA). At day 0 the transfection was done ...
-
bioRxiv - Bioengineering 2021Quote: ... All experiments were performed in 384-well plates (Clear Flat-Bottom Immuno Nonsterile 384-Well Plates, MaxiSorp, Life Technologies) which were sealed (Empore Sealing Tape Pad ...
-
bioRxiv - Neuroscience 2020Quote: ... Dissociated hippocampal or cortical neurons were plated at 17,000 cells/well (96-well plate) or 1,000,000 cells/well (6-well plate) in neuron media (Neurobasal medium (ThermoFisher 21103049) supplemented with B27 (ThermoFisher 17504044) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 384-well plate was loaded on the the TaqMan Open Array Human MicroRNA Panel plates (Thermo Fisher, USA) and analyzed using QuantStudio™ 12K Flex (Thermo Fisher ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Fresh primary hepatocytes (3.0 × 106 cells/plate) were cultured on 60 mm Permanox plates (Thermo Fisher Scientific, Waltham, MA) coated with Type I collagen ...
-
bioRxiv - Neuroscience 2020Quote: ... the plate was washed 4 times with PBST using an automated plate washer (Thermo Fisher Scientific Wellwash Versa, USA), and the samples were incubated in anti-pTRKB antibodies diluted 1:1000 in the blocking buffer overnight at 4° C ...
-
bioRxiv - Immunology 2021Quote: ... USA) was immobilized on a 96-well plate (442404, MAXISORP F96 NUNC Immuno-plate, Thermo Fisher Scientific, Roskilde, Denmark) at 4 °C overnight ...
-
bioRxiv - Microbiology 2020Quote: ... Centrifuge filter plate on top of a new well-plate (#2, wV 200 ul e.g. 269787, Nunc, Roskilde, DK) at 900 x g for 2 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1.5×105 4T1 cells were co-cultured in 6 wells plates using Transwell plates (0.4 μm, Nunc, ThermoFisher Scientific) with Gr1+CD11b+ sorted cells (top ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1.5×105 4T1 cells were co-cultured in 6 wells plates using Transwell plates (0.4 μm, Nunc, ThermoFisher Scientific) with Gr1+CD11b+ sorted cells (top ...
-
bioRxiv - Microbiology 2022Quote: ... a TECAN infinite f plex plate reader and black 96-well luciferase plates (Thermo Fisher Scientific Nunc A/S).
-
bioRxiv - Microbiology 2022Quote: ... a TECAN infinite f plex plate reader and black 96-well luciferase plates (Thermo Fisher Scientific Nunc A/S).
-
bioRxiv - Microbiology 2022Quote: Elution plate lid: Nunc™ 96 Well Caps for 1.0mL Polystyrene DeepWell™ Plates (Thermo Scientific, cat. no. 278616)