Labshake search
Citations for Thermo Fisher :
2951 - 3000 of 10000+ citations for 7 Chloro 1 3 dihydro imidazo 4 5 c pyridin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 1:2000 LipidTOX was added along with 0.25 μg/ml of 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes) for 15 min ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell nuclei were stained with 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, 1:1000, Invitrogen, Thermo Fisher Scientific, MA) for 10 mins ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell nuclei were stained with 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, 1:1000, Invitrogen, Thermo Fisher Scientific, MA) for 10 mins ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cell pellets were finally resuspended in wash buffer containing 1 µg/ml 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) or 7-AAD viability dye (BioLegend ...
-
bioRxiv - Bioengineering 2024Quote: ... PEGαMA hydrogels were made by dissolving the PEGαMA in pH 8.4 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Life Technologies) at 12.5-15.5 weight percent (wt%) ...
-
bioRxiv - Immunology 2019Quote: ... 5’ ATCCGCACCGACTCGGT 3’ and Rv: 5’ GCGTAATACGACTCACTATAG 3’ and purified using the Quick gel extraction and PCR purification combo kit (00505495, ThermoFisher). The PCR products were confirmed by an agarose gel electrophoresis and by Sanger sequencing (Base Clear ...
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Immunology 2021Quote: ... and incubated overnight at 4°C with rat anti-mouse CD8 (4SM15, Invitrogen) and rabbit anti-mouse Ly6G (E6Z1T ...
-
bioRxiv - Neuroscience 2019Quote: ... Lysates were incubated overnight at 4°C with magnetic Dynabeads (Thermo Fisher Scientific) conjugated to Guinea pig anti-Syp and IgG antibody ...
-
bioRxiv - Neuroscience 2022Quote: ... submerged at 4°C in Bolt™ MOPS SDS Running Buffer (ThermoFisher, B0001) using Mini Gel Tank and Blot Module Set (ThermoFisher ...
-
bioRxiv - Neuroscience 2022Quote: ... the blot was incubated overnight at 4°C with AT8 primary antibody (Invitrogen) diluted 1:1000 in blocking buffer ...
-
bioRxiv - Microbiology 2020Quote: ... coated overnight at 4°C with 100 µL of fibrinogen (20 µM, Invitrogen) or fibronectin (50 µM ...
-
bioRxiv - Immunology 2021Quote: ... Cells were incubated (4 °C, 20 min) in Live/Dead Fixable Aqua (ThermoFisher). Following a wash ...
-
bioRxiv - Pathology 2022Quote: ... at 4°C overnight and mounted using Prolong Gold mounting medium (P36934, Thermofisher). Image acquisition was performed on an EVOS epifluorescence microscope (Life Technologies) ...
-
bioRxiv - Neuroscience 2021Quote: ... overnight at 4 °C and with DAPI (0.5 µg/ml; D1306, Thermo Fisher) for 30 min at room temperature in PBS ...
-
bioRxiv - Bioengineering 2022Quote: ... and the solution was precipitated into cold (4°C) acetone (>99%, Fisher Scientific). The precipitate was spun down and re-dissolved into DI water ...
-
bioRxiv - Biochemistry 2022Quote: ... 4°C and total protein determined by the BCA method (Thermo Fisher Scientific). Proteins were separated on a Bolt 4–12% Bis-Tris Plus Gel (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2022Quote: ... was carried out overnight at 4°C using Protein A Dynabeads (ThermoFisher Scientific). The mononucleosomal fraction (147 bp ...
-
bioRxiv - Neuroscience 2022Quote: ... c-organoids were washed in D-PBS before fixing in 4% PFA (ThermoFisher) for 15 minutes at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... the sections were incubated overnight at 4 °C with chicken anti-GFP (ThermoFisher). Then sections were washed in PBST 4 times for 10 min ...
-
bioRxiv - Bioengineering 2022Quote: ... Samples were kept a 4 °C in an autosampler (Thermo Fisher UltiMate 3000). Five μL of the sample were injected into a C18 column (Merck Spherisorb ODS-2 (5 μm) ...
-
bioRxiv - Microbiology 2024Quote: ... Immunoprecipitations were performed overnight at 4°C with Dynabeads Protein G beads (Invitrogen) conjugated to mouse anti-FLAG M2 (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2023Quote: ... tissues were incubated at 4°C with Alexa Fluor-conjugated secondary antibodies (Invitrogen) and DAPI (1:1000 dilution) ...
-
bioRxiv - Developmental Biology 2022Quote: ... organoids were incubated overnight at 4°C with fluorescent secondary antibodies (Molecular Probes) diluted 1:200 in blocking buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The cultures were harvested and kept at 4°C while FM4-64 (ThermoFisher) was added 1:50 to the cells for 10 minutes ...
-
bioRxiv - Plant Biology 2023Quote: ... Overnight incubation at 4 °C with primary antibodies Anti-Myc (ThermoFisher, https://www.thermofisher.com/) and Anti-HA Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... The mixture was centrifuged (300 ⍰ g, 8min, 4°C) (Thermo Scientific, cat # 50136519) and then filtered through a 70 μm cell strainer (Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Decapsulated embryos were fixed at ∼20°C with 4% formaldehyde (Thermo Scientific # 28908) in double filtered sea water for 60 minutes on a shaking plate followed by three 1 minute 1X PBS Tween (1X Phosphate Buffered Saline ...
-
bioRxiv - Neuroscience 2023Quote: ... The cells were spun down at 4 °C and resuspended in PBS (Gibco) containing 15 mM NaN3 (Sigma-Aldrich ...
-
Epigenetic deregulation of IFN and WNT pathways in AT2 cells impairs alveolar regeneration (in COPD)bioRxiv - Cell Biology 2023Quote: ... primary antibodies at 4°C in incubation buffer (TSB kit, Thermo Fisher Scientific). Mouse IgM and rabbit IgG were used as controls ...
-
bioRxiv - Cell Biology 2024Quote: Ultracentrifuge at 1,20,000g for 2h at 4°C (Optima max instrument, Thermo Scientific).
-
bioRxiv - Cell Biology 2024Quote: ... 4°C using a 3,500 Da molecular weight cutoff membrane (Thermo Fisher Scientific). The N-terminal hexahistidine tag was cleaved with ∼2 units of thrombin (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... skin was incubated overnight at 4°C with RNA Later solution (#10391085, Invitrogen) and then stored at -80°C ...
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Bioengineering 2023Quote: Passage 3 and passage 4 cells from 8 donors (4 male and 4 female) were expanded in T175 flasks (Thermo Fisher Scientific, Hampton, New Hampshire USA) and were cultured until passage 5 (p3-5 and p4-5 ...
-
bioRxiv - Neuroscience 2020Quote: ... tissues were washed in PBS (3×5 min) and incubated with secondary antibodies conjugated to Alexa Fluor 488 (1:400; goat anti–rabbit; Life Technologies) or Alexa Fluor 594 (1:400 ...
-
bioRxiv - Microbiology 2021Quote: ... 1.5 µl of 3 ng µl-1 cDNA was used as template in the QuantStudio 5 Real-Time PCR system (Applied Biosystems). Amplifications were performed with 5 μl of SYBR® green JumpStart Taq ReadyMix (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slices were then washed in PBS (3 × 10 min) followed by a 5 min incubation with DAPI (Thermofisher Scientific, 1: 5000) diluted in PBS ...
-
bioRxiv - Immunology 2020Quote: ... 3.125 μM Oligo-dT 30 VN (IDT, 5’AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3.125 μM Oligo-dT 30 VN (IDT, 5′AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3′) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Developmental Biology 2022Quote: ... with cDNA (diluted 1:5) and gene-specific primers (Key Resources Table) on a QuantStudio 3 Real-Time PCR System (Applied Biosystems) in triplicate ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were washed in 0.3% Triton-X/PBS 3× 5 min and incubated with secondary antibody (goat anti-rabbit-Alexa Fluor 594: 1:800, Life Technologies) for one hour ...
-
bioRxiv - Cell Biology 2021Quote: ... Slides were then washed 3 x 5 minutes with PBS and incubated with the Anti-guinea pig IgG Alexa Fluor 488 (1:200, Life Technologies) diluted in 10% FBS for 1 hour at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.1 μM 6-JOE-conjugated reverse primer (5’-6-JOE-GATGATCTCCACCTTGCCGT-3’) was extended with 1 pmol of RNA as template using Superscript III (Thermo Fisher) as reverse transcriptase ...
-
bioRxiv - Genetics 2023Quote: ... Ovaries were washed 3 times for 5 min with PBTx before incubation at room temperature in 1 μg/mL DAPI (Invitrogen, ThermoFisher Scientific) solution in PBS for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GAGACCCUAUCCGUGAUUAtt-3’ and antisense: 5’- UAAUCACGGAUAGGGUCUCtt-3’ (Silencer Select, rat negative control #1; scrambled siRNA and all siRNAs were from Ambion, Life Technologies). Transfection complexes were prepared in accordance with the instructions provided by the manufacturer and added to 2×105 cells seeded per well in 24-well plates.