Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for Probable U3 small nucleolar RNA associated protein 11 UTP11 Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... small RNAs (<200nt) were extracted using mirVanaTM miRNA Isolation Kit (Ambion, Life Technologies, AM1560) as described by the manufacturer ...
-
bioRxiv - Cell Biology 2021Quote: ... small RNAs (<200nt) were extracted using mirVanaTM miRNA Isolation Kit (Ambion, Life Technologies, AM1560) as described by the manufacturer ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were transfected with small interfering RNAs (siRNAs) using Lipofectamine 3000 reagent (Invitrogen, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... the small RNA species were isolated and concentrated using the mirVana PARIS Kit (Ambion). Small RNA fractions from cells (∼1.5 μg ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with small interfering RNAs (siRNAs) using Lipofectamin RNAi Max (Life Technologies). Specifically ...
-
bioRxiv - Neuroscience 2022Quote: ... Total cellular RNA was extracted from small pieces of organoids using TRIzol Reagent (Invitrogen) and a Direct-zol RNA MiniPrep kit (Zymo Research) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and small RNAs (< 200 nt) were enriched with the mirVana miRNA Isolation Kit (Ambion). The RNAs were resolved on 15% urea-polyacrylamide gels ...
-
bioRxiv - Molecular Biology 2024Quote: ... Small RNA was extracted using Purelink miRNA isolation kit (Thermo Fisher Scientific, Cat# K157001) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... aeruginosa clinical strains was detected by custom Taqman Small RNA Assay (#4398987, ThermoFisher Scientific), according to the manufacturer′ s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and small RNAs were enriched by an mir-Vana miRNA isolation kit (Thermo Scientific). Samples were pretreated with homemade PIR-1 or 5’ Pyrophosphohydrolase (RppH ...
-
bioRxiv - Molecular Biology 2023Quote: ... and used for Collibri small-RNA-seq library preparation reactions following manufacturer protocols (INVITROGEN). The resulting NGS adapter ligated cDNA was then amplified with KAPA HiFi HotStart ReadyMix using NGS indexing primers for 25 cycles (ROCHE) ...
-
bioRxiv - Cancer Biology 2023Quote: ... with small interfering RNA (siRNA) using Lipofectamine RNAiMAX (Invitrogen, Thermo Fisher Scientific, MA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... with small interfering RNA (siRNA) using Lipofectamine RNAiMAX (Invitrogen, Thermo Fisher Scientific, MA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with 20 µM Rho-associated coiled-coil forming protein serine/threonine kinase inhibitor (ROCK-I, compound Y-27632) (ThermoFisher) and transferred to a 6-well ultra-low attachment plate (Corning ...
-
bioRxiv - Developmental Biology 2024Quote: ... and peroxidase activity associated with proteins of interest was detected with SuperSignal West Femto Maximum Sensitivity Substrate (#34094, Thermo Fisher).
-
bioRxiv - Developmental Biology 2024Quote: ... Detection of purified proteins and associated complexes was performed by immunoblot analysis using chemiluminescence (Immobilon Crescendo/Forte; Thermo Fisher Scientific). Western blots were probed with mouse anti-FLAG (M2 ...
-
Investigations on regulation of miRNAs in rice reveal [Ca2+]cyt signal transduction regulated miRNAsbioRxiv - Plant Biology 2021Quote: ... 2 μg of RNA was incubated with 100 pmoles of either oligodT primer (Eurofins Genomics) for total RNA or miR_oligodT primer (Eurofins Genomics) for small RNA using the SuperscriptII cDNA synthesis kit (Invitrogen). All the primers have been enlisted in Supplementary Table S1.
-
bioRxiv - Molecular Biology 2024Quote: ... Fractions corresponding to mRNA associated with more than two ribosomes were pooled and the RNA extracted using TRIzol (ThermoFisher) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... The quality and concentration of RNA were assessed using a QuBit 4 Fluorometer and associated kits (Thermo Fisher Scientific) and an Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary antibodies: cardiac troponin T (13-11; Thermo Fisher, MA5-12969; 1:100) and (CT3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The RNA-protein-antibody complex was captured using protein A/G magnetic beads (Thermo Fisher Scientific, 10002D and 10004D). Magnetic beads were washed with low salt buffer (1X PBS ...
-
bioRxiv - Microbiology 2022Quote: ... α-mannose binding lectin C (primary: mAb 14D12, Abcam catalog no. ab106046; secondary: Mouse anti-Rat IgG2a, FITC, Thermofisher catalog no. 11-4817-82), α- IgM (mAb II/41 ...
-
bioRxiv - Microbiology 2022Quote: ... α-mannose binding lectin A (primary: mAb 8G6, Hycult catalog no. HM1035; secondary: Mouse anti-Rat IgG2a, FITC, Thermofisher catalog no. 11-4817-82), α-mannose binding lectin C (primary ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human endothelial cells in muscles were stained with biotinylated Ulex Europaeus Agglutinin I Lectin (UEA I, B-1065-2, Vectorlab, 1:100 dilution) and FITC-streptavidin (11-4317-87, Invitrogen, 1:250 dilution). Nuclei was stained with DAPI ...
-
bioRxiv - Cancer Biology 2020Quote: ... The FITC-labeled anti-BrdU antibody was purchased from Thermo Fisher Scientific (11-5071-42 ...
-
bioRxiv - Cell Biology 2020Quote: ... and then with secondary antibodies conjugated with FITC or Alex (Invitrogen) according to the manufacturer’s directions ...
-
bioRxiv - Biochemistry 2022Quote: ... A mixture containing 20µL LUV and 8µg anti-FITC antibody (Thermofisher) was prepared ...
-
bioRxiv - Immunology 2021Quote: ... Polyclonal FITC rabbit anti-mouse antibody was purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Cell Biology 2022Quote: ... Secondary antibodies were conjugated with FITC (1:500, Thermo Fisher Scientific), TRITC (1:500 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... A small volume of each sample was used to immediately measure protein concentration with the Pierce BCA Protein Assay kit (ThermoFisher; 23227). The rest was combined with 6X loading dye (375mM Tris pH 6.8 ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA was synthesized from 5 ng of total RNA using TaqMan® Small RNA Assays RT-primers (Thermo Fisher Scientific) with the High-Capacity cDNA Reverse Transcription Kit ...
-
bioRxiv - Neuroscience 2024Quote: ... A small aliquot was taken to measure the protein concentration using the BCA assay (ThermoFisher Scientific), and the remaining protein was stored at -80°C until being processed ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 ug of small RNA purified by the mirVana miRNA Isolation kit (Thermo Fisher Scientific) was heated at 90 °C for 20 sec with gel loading buffer II (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... For the knock down of Plk1 small interfering RNA (siRNA) duplexes AACGAGCTGCTTAATGACGAGTT were used (ThermoFisher). For Astrin siRNA oligo #367 (5′-TCCCGACAAC TCACAGAGAAA -3′)(Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... cDNA and small interfering RNA-expressing constructs were transiently transfected with Lipofectamine 2000 (Life Technologies) according to manufacturer’s instructions.
-
bioRxiv - Plant Biology 2021Quote: ... The small RNA (<200 nt) fraction was purified with the mirVana miRNA isolation kit (ThermoFisher) prior to small RNA sequencing library preparation using the NEBNext Small RNA kit (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Small RNA concentration and quality were assessed on a NanoDrop ND-2000 (Thermo Fisher Scientific) and 2200 TapeStation System with Agilent RNA ScreenTapes (Agilent Technologies) ...
-
bioRxiv - Microbiology 2023Quote: Cells were transfected with relevant small interfering RNA (siRNA) oligonucleotide using Lipofectamine RNAiMAX (Life Technologies), according to the reverse transfection procedure described in the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... Large and small RNA species were differentially recovered using the PureLink miRNA Isolation Kit (Invitrogen) with 35% ethanol and 70% ethanol respectively ...
-
bioRxiv - Plant Biology 2022Quote: ... The small RNAs were isolated using the PureLink™ miRNA Isolation Kit (K1570-01, Invitrogen) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2024Quote: ... 100 ng of small RNA fraction were labelled using the NCODETM miRNA labelling system (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... 12 pmol small interfering RNA (siRNA) and 2 μL Lipofectamine RNAiMAX Transfection Reagent (Invitrogen, #13778075) were each diluted in 50 μL serum-free medium ...
-
bioRxiv - Cell Biology 2024Quote: ... WT MEFs were silenced for TG2 by Small Interference RNA (siRNA) using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... biopsies were co-cultured with 3T3-J2 fibroblasts and Rho-associated protein kinase inhibitor (Y-27632) in epithelial cell expansion medium consisting of a 3:1 ratio DMEM:F12 (Gibco, UK; 21765), 1X penicillin/streptomycin and 5% FBS (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... Immunofluorescence was done on brain sections to assess expression of plasticity associated proteins Nogo-A and BDNF with rabbit anti-Nogo-A (1:200; Invitrogen, USA), rabbit anti-BDNF (1:500 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 × 10^6 cells were washed with PBS supplemented with 0.5% BSA and 0.1% sodium azide and stained with FITC-conjugated anti- CD5 (eBioscience, cat. 11-0051-85) and with PE-Cy7-conjugated anti-CD19 (Invitrogen , cat. 25-0193-82) antibodies ...
-
bioRxiv - Cancer Biology 2022Quote: ... for endothelial cells, anti-CD133 FITC (11-1339-42, eBioscience, San Diego, CA, USA) for stem cells and Hoechst 33342 (62249, Thermofisher Scientific, Waltham, MA, USA) for nuclei ...
-
Recruitment of the m6A/Am demethylase FTO to target RNAs by the telomeric zinc finger protein ZBTB48bioRxiv - Molecular Biology 2024Quote: ... RNA-protein complexes were immunoprecipitated using 5 μg antibody (either anti-ZBTB48, or anti-GFP antibody (Life Technologies G10362), or anti-FLAG ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA (300 ng) and chromatin-associated RNAs (200 ng) were reverse transcribed using random primers and Superscript III reverse transcriptase (Invitrogen). Indicated RNAs were quantified by qPCR on Applied Biosystems qPCR instrument in the presence of SYBR green with the primer sequences listed in Supplementary Table 8 using the ΔCT method ...
-
bioRxiv - Molecular Biology 2024Quote: ... The ribosome protected RNA fragments associated with monosomes and disomes were recovered from the ribosomal pellet using a mirVana microRNA isolation kit (Invitrogen). Instead of radioactively end labeling the RNA fragments to size select the ribosome protected RNA fragments by SDS-PAGE as described in the original protocol Ingolia etal ...