Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for Probable U3 small nucleolar RNA associated protein 11 UTP11 Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... 0.05 mM biotin-11-dUTP (Thermo Scientific); 10 mM 2-mercaptoethanol ...
-
bioRxiv - Immunology 2021Quote: ... IgD (Clone 11-26c, Thermo Fisher Scientific), CTLA4 (Clone UC10-4B9 ...
-
bioRxiv - Immunology 2021Quote: ... anti-CD3-AF700 (11-0039-42, ThermoFisher), Sytox Blue Viability Stain (S34857 ...
-
bioRxiv - Systems Biology 2022Quote: ... in RPMI 1640 (Gibco, 11-875-119) media supplemented with 10% FBS (Takara ...
-
bioRxiv - Immunology 2022Quote: Busulfan (Fisher Scientific, Cat# 11-101-7872) was dissolved in DMSO and diluted with 0.9 percent saline to obtain of 5 mg/ml busulfan in 30% DMSO ...
-
bioRxiv - Plant Biology 2024Quote: ... 11 μl of RnaseCocktail (ThermoFisher, ref AM2288) were added and the lysate was incubated in a rotator at 37°C for 20 minutes ...
-
bioRxiv - Plant Biology 2024Quote: TMT (11-plex) reagents (ThermoFisher, Cat#A34808) were reconstituted in anhydrous acetonitrile (0.01mg/uL) ...
-
bioRxiv - Molecular Biology 2024Quote: ... in RPMI 1640 (Gibco, 11-875-119) media supplemented with 10% FBS (Omega Scientific ...
-
bioRxiv - Synthetic Biology 2022Quote: ... in RPMI 1640 (Gibco, 11-875-119) media supplemented with 10% FBS (Omega Scientific ...
-
bioRxiv - Pathology 2023Quote: ... Ly-6G (ThermoFisher Scientific, 11-9968-82), cleaved caspase-3 (Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2023Quote: ... Collagenase 11 (2mg/mL; Gibco; 17101-015), DNAse (20U/mL ...
-
bioRxiv - Pathology 2024Quote: ... IL-11 (1:1500, PA5-95982, Invitrogen) and Gapdh (1:3000 ...
-
bioRxiv - Systems Biology 2024Quote: ... 1-methylnicotinamide (Fisher Scientific 11-101-2274), reduced glutathione-ester (MilliporeSigma G6013-5G) ...
-
bioRxiv - Cell Biology 2024Quote: ... 11 mM glucose + 50 µM IBMX (Gibco), 11 mM glucose + 1 μM liraglutide (DBA ...
-
bioRxiv - Cell Biology 2024Quote: ... NEAA (Thermo Fisher Scientific, 11-140-050), human BDNF (10 mg/L ...
-
bioRxiv - Immunology 2022Quote: ... in PBS + 2% BSA + 0.1 % Triton X-100 and secondary antibody + FITC-phalloidin (Molecular Probes, D1306) + DAPI (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were harvested and stained with anti-CD3 FITC antibody (UCHT1; Thermo Fisher Scientific, 1:100), washed in FACS buffer before the addition of DAPI and flow cytometry analysis ...
-
bioRxiv - Microbiology 2021Quote: ... and R140-labeled cells were then incubated with a FITC-conjugated anti-rabbit secondary antibody (ThermoFisher). After 30 minutes ...
-
bioRxiv - Genomics 2021Quote: ... Cells were then fluorescently labeled using CD163-FITC mouse conjugated monoclonal antibody (Thermo Fisher, MA5-17719). Cells that presented high CD163 levels were sorted using an Aria 2 Flow Cytometer (BD Biosciences ...
-
bioRxiv - Developmental Biology 2022Quote: ... and then in goat antirabbit FITC secondary antibody (10 μg/ml in blocking solution, Molecular Probes). Finally ...
-
bioRxiv - Molecular Biology 2024Quote: ... we washed sections and incubated them with FITC-conjugated secondary antibody (Invitrogen, Thermo Fisher, 1:300). After washing the tissues three times in phosphate-buffered saline (PBS) ...
-
bioRxiv - Molecular Biology 2024Quote: ... we washed sections and incubated them with FITC-conjugated secondary antibody (Invitrogen, Thermo Fisher, 1:300). After washing the tissues three times in phosphate-buffered saline (PBS) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and secondary anti-rabbit Alexa Fluor549 and anti-mouse FITC-labeled antibodies (1:200 dilution; Invitrogen) for another hour at RT ...
-
bioRxiv - Molecular Biology 2022Quote: ... we performed RNA-Protein pull-down assay by using Pierce™ Magnetic RNA-Protein Pull-Down Kit (Thermo Fisher Scientific). The biotin labeled RP24-315D19.10 and AS-RP24-315D19.10 probe was designed and synthesized by GenePharma company ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria-associated ROS (PE channel) levels were measured with MitoSOX Red (Invitrogen, M36008) at 2.5 μM for 30 min at 37 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10^10 adeno-associated viral particles were resuspended in PBS (Thermo Fisher Scientific) and Matrigel matrix (Corning ...
-
bioRxiv - Microbiology 2020Quote: ... and associated reagents (Qubit 1x dsDNA HS Assay Kit, Fisher Scientific, Pittsburgh, PA) in thin-walled polypropylene tubes (Qubit Assay Tubes ...
-
bioRxiv - Cell Biology 2020Quote: Small interfering RNA (siRNA) (GE Dharmacon) was transfected at a final concentration of 50 nM using Lipofectamine (RNAiMAx, Life Technologies).
-
bioRxiv - Biochemistry 2020Quote: ... one µg of small RNAs was mixed with 2 µg of HPDP-Biotin (ThermoFisher Scientific, 1 mg/ml in DMSO). The reaction was incubated for three hours at room temperature protected from light and mixed every 15 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: Small RNAs were first isolated from liver tissue using PureLink™ miRNA Isolation Kit (catalog no. K157001, Invitrogen, Waltham, MA). RNA concentration was then quantified at The Center for Functional Genomics/University at Albany using an Agilent Technologies 2100 Bioanalyzer System (Santa Clara ...
-
bioRxiv - Cell Biology 2022Quote: ... PANC-1 shTAK1 stables were selected using puromycin (10 ug/mL) after small hairpin RNA vector transfection using Lipofectamine 2000 (Invitrogen). Cells were grown in 5% CO2 and at 37°C.
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transfected with scrambled small interfering RNA or small interfering RNA (siRNA) to silence TMX4 expression (5′-GCAUGGUGUUCUUACGUUUtt-3′, 100 nM per dish, Silencer Select Pre-designed, Ambion). Cells were processed for immunofluorescence or for biochemical analyses after 48h of transfection.
-
bioRxiv - Systems Biology 2020Quote: STHdhQ111/Q7 cells were reverse transfected with pooled small interfering RNAs (siRNAs) using Lipofectamine 2000 (Life Technologies, cat. no. 11668). Cells were treated with a pool of four small siRNAs per gene with the following sequences (Qiagen 1027280):
-
bioRxiv - Cell Biology 2020Quote: ... the cells were transfected with 8μl (10 μM) small interfering RNA (sc-43983, Sant Cruz Biotechnology) with 8 μl Lipofectamine™ RNAiMAX (Invitrogen) for 6 hours according the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNAi was achieved by transfection of cells for 48 hr with 20 nM small interfering RNA (siControl [D-001210-02] and siMus81 [CAGCCCUGGUGGAUCGAUAUU], Dharmacon) using Lipofectamine RNAiMAX (Invitrogen) and Optimem (Gibco) ...
-
bioRxiv - Microbiology 2020Quote: ... Small RNAs were extracted from the germinated spores and infected leaf samples with the Purelink microRNA Isolation Kit from Invitrogen. We sequenced sRNAs (50 bp reads ...
-
bioRxiv - Neuroscience 2021Quote: ... Two-round T7-RNA polymerase-mediated linear amplification was performed according to optimized protocols for low-input RNA amounts (Small Sample Target Labeling Assay Version II, Affymetrix). Biotin-labeled second-round aRNA was generated with an NTP-mix containing Biotin-11-CTP and Biotin-16-UTP (PerkinElmer ...
-
bioRxiv - Genomics 2022Quote: ... The small RNA TaqMan assays were performed according to the manufacturer’s instructions using the selected primer/probe assays (ThermoFisher Scientific), which are also specific for canine miRNAs ...
-
bioRxiv - Cell Biology 2023Quote: ... To deplete LaminA from RPE-1 cells were transfected with small interfering RNAs (siRNAs) using Lipofectamin RNAi Max (Life Technologies). Specifically ...
-
bioRxiv - Microbiology 2024Quote: Small RNA (<200 nt) was isolated directly from the pellets of infected RBCs using the mirVana miRNA isolation kit (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: HepG2 cells and HepG2DNAJB1-PRKACA clones were transfected in 96-well plate with 0.25-100 nM Silencer small interfering RNA (siRNA) (Negative Control: #1, CDK7: s2830) (Life Technologies) using Lipofectamine RNAiMAX transfection reagent (Life Technologies) ...
-
bioRxiv - Plant Biology 2023Quote: ... was used to enrich the small RNA using equal volumes of 4M LiCl followed by polyadenylation using a Poly(A) Tailing Kit (Ambion). An amount of 2 μg of polyadenylated small RNA and total RNA was reverse transcribed using miR_oligodT_RTQ (100 bp ...
-
bioRxiv - Molecular Biology 2023Quote: One day after seeding 106 U2OS cells in 6-well plate, small interfering RNAs (siRNA, 20μM) were delivered using Lipofectamine® RNAi-MAX Reagent (Invitrogen) according to the supplier’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: HAECs were plated at a density of 3 x 105 cells/well in 6-well format before being transfected with FOXO1 small interfering RNA (siRNA) or scramble siRNA (ON-TARGETplus, Dharmacon) (Table S3) for 4 h in Opti-MEM medium (Gibco) using Lipofectamine RNAiMAX transfection kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... The concentration of the Cas7-11–Csx29–crRNA complex was measured using Pierce 660-nm Protein Assay Reagent (Thermo Fisher Scientific). Csx30 was expressed in E ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA (1 μg) was reversed transcribed to cDNA using SuperScript™ VILO™ Master Mix (Invitrogen, 11-755-050).
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: ... Total RNA (1 μg) was reversed transcribed to cDNA using SuperScript™ VILO™ Master Mix (Invitrogen, 11-755-050) and RT-PCR performed on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... 11 μl of extracted RNA were subjected to retrotranscription using SuperScript IV kit (SSIV, Invitrogen by Life Technologies, Carlsbad, USA) according to manufacturer’s specifications and using random hexamers as primers ...
-
bioRxiv - Microbiology 2024Quote: ... 11 μl of extracted RNA were subjected to retrotranscription using SuperScript IV kit (SSIV, Invitrogen by Life Technologies, Carlsbad, USA) according to manufacturer’s specifications and using random hexamers as primers ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein-DNA-antibody complexes were precipitated with protein G-magnetic beads (Invitrogen) for 1hr at 4°C ...