Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative PCR reactions were carried out with the indicated primer pairs (Eurofins MWG Operon, 500 nM final concentration, Supplementary Table 5) and Power SYBR® Green PCR Master Mix (Applied Biosystems) and read in MicroAmp® Fast Optical 96-well plates (Applied Biosystems ...
-
bioRxiv - Plant Biology 2021Quote: ... H2AK115R/K116R and H2AK119R were amplified by two pairs of primers (LH3848/LH4309 and LH3848/LH3849) and sub-cloned into the pENTR-TOPO vector (Thermo Fisher Scientific) to generate pENTR-H2AK115R/K116R and pENTR-H2AK119R ...
-
bioRxiv - Cell Biology 2020Quote: ... Duplex reaction format was utilized with FAM-labeled probe/primer pairs for the gene of interest and VIC-labeled probe/primer-limited pairs for TBP (Tata-Binding Protein) as the normalizer gene (ThermoFisher, Waltham, MA). For real-time PCR reactions ...
-
bioRxiv - Microbiology 2022Quote: ... The cDNA fragment contained in each clone was PCR amplified using gene specific primer pairs and the Platinum SuperFi II mastermix (Invitrogen™, ThermoFisher) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... to determine the transcript expression of target genes using the respective primer pair and SYBR green master mix (#A25741, Thermo Scientific, US). Gapdh was used as the housekeeping gene for normalization ...
-
bioRxiv - Immunology 2023Quote: ... in order to conduct real-time PCR using the indicated primer pairs from PrimerBank (24) (Table S1) with SYBR Green master mix (ThermoFisher, Waltham MA).
-
bioRxiv - Neuroscience 2024Quote: ... primer pairs targeting wildtype with or without cryptic sequences (see table below) and Phusion Plus Green PCR Master Mix (Thermo Scientific, F632L). Upon cryptic exon inclusion ...
-
bioRxiv - Microbiology 2024Quote: ... The PB025 plasmid was linearized and gadB-directed sgRNA was introduced using the B1/B2 primer pair (Table S1) and Phusion High-Fidelity PCR Master Mix (Thermo Scientific™). The residual circular plasmid was digested with DpnI (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... and the aqueous phase was used as a template for RT-PCR with specific primer pair against FoIV1 ORF4 (Supplementary Table S2) using the SuperScript III One-Step RT-PCR System (Thermo Fisher Scientific).
-
bioRxiv - Genomics 2024Quote: ... forward and reverse primers (800 nM; BLVpol_5f: 5′-CCTCAATTCCCTTTAAACTA-3′; BLVpol_3r: 5′-GTACCGGGAAGACTGGATTA-3′; Thermo Fisher Scientific), and 200 ng of gDNA template ...
-
bioRxiv - Immunology 2023Quote: ... was used in every qPCR reaction using KAPA probe Fast qPCR kit (Kapa Biosystem, cat#KK4706) with primers targeting 45S (Thermofisher Scientific, cat# Mm03985792_s1) and 18S (Thermofisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... The primers used in the RT-qPCR assay were synthesized by Life Technologies (ThemoFisher Scientific) based on sequences retrieved from Primer Bank (http://pga.mgh.harvard.edu/primerbank/ ...
-
bioRxiv - Plant Biology 2022Quote: ... qPCR was performed using gene-specific primers using PowerUp SYBR Green master mix (Applied Biosystems) and Bio-Rad CFX9 connect thermocycler (Bio-Rad) ...
-
bioRxiv - Biochemistry 2022Quote: ... cell culturing reagents and primers and reagents used for qPCR were obtained from Life Technologies Inc ...
-
bioRxiv - Neuroscience 2020Quote: ... Uniplex qPCR was preformed using TaqMan Fast Advanced Master Mix and FAM labeled primers (ThermoFisher) with a ViiA 7 System (Applied BioSystems) ...
-
bioRxiv - Plant Biology 2024Quote: ... qPCR was carried out with specific primers on 7500 Real-Time PCR System (Applied Biosystems) using comparative Ct method with Fast SYBR™ Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... All qPCR reactions (10 µl) were executed in a QuantStudio 3 qPCR system (Applied Biosystems, Thermo Fisher Scientific) and contained 5 µl PowerUp SYBR Green Master Mix with UNG (uracil-N glycosylase to prevent carryover contamination ...
-
bioRxiv - Microbiology 2020Quote: ... All qPCR reactions (10 µl) were executed in a QuantStudio 3 qPCR system (Applied Biosystems, Thermo Fisher Scientific) and contained 5 µl PowerUp SYBR Green Master Mix with UNG (uracil-N glycosylase to prevent carryover contamination ...
-
bioRxiv - Bioengineering 2022Quote: ... 6 ng of cDNA was used per qPCR reaction consisting of gene-specific primers (Supplementary Information Table 3) and amplified with the PowerSYBR Green Master Mix (Applied Biosystems in a CFX-96 thermocycler (Bio-Rad). Data was acquired using the Bio-Rad CFX Manager 3.1 ...
-
bioRxiv - Immunology 2021Quote: ... 2 ng/mL TGF-β from Invitrogen (14834262), 20 ng/mL IL-6 from PeproTech (216-16) ...
-
bioRxiv - Genetics 2021Quote: ... and qPCR was performed in a QuantStudio 3 instrument (Applied Biosystems).
-
bioRxiv - Developmental Biology 2020Quote: ... Quantitative PCR (qPCR) was performed using QuantStudio 3 (Thermo Fisher, U.S.) following the MIQE guideline(Bustin et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... QPCRs were performed in the Quantstudio 3 apparatus (Thermo Fisher Scientific) with GoTaq qPCR master mix 2X with SYBR Green (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed on the QuantStudio 3 (Thermo Fisher Scientific) platform and the cycling conditions were as follows ...
-
bioRxiv - Developmental Biology 2022Quote: ... qPCR was run using a QuantStudio 3 machine (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2022Quote: ... qPCR was performed using a QuantStudio 3 (Applied Biosystems, Waltham, MA) with the following conditions ...
-
bioRxiv - Microbiology 2024Quote: ... The qPCR reactions were run on a QuantStudio 3 (Applied Biosystems). The data were normalized using a standard curve from gDNA extracted from purified EBs.
-
bioRxiv - Neuroscience 2023Quote: ... on a QuantStudio 3 qPCR system (ThermoFisher Scientific, Waltham, MA, US).36b4 gene encoding for acidic ribosomal phosphoprotein P0 was selected as house-keeping control due to its high stability in adipose tissues (Zhang et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... qPCR analyses were performed using a QuantStudio 3 thermocycler (Applied Biosystems); gene expression is presented using the ΔΔCt method (18S or Gapdh genes used as housekeeping).
-
bioRxiv - Molecular Biology 2023Quote: ... The qPCR reaction was run on a QuantStudio 3 (Applied Biosystems) and data analysed with Design and Analysis 2.7.0 software (Applied Biosystems).
-
bioRxiv - Cancer Biology 2023Quote: ... qPCR was performed with QuantStudio 3 Detection System (Thermo Fisher Scientific) in a 20 μL reaction mixture containing SYBR Green PCR Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: ... Real-time qPCR was performed using QuantStudio 3 instruments (Applied Biosystems). The mixture for qPCR reaction was prepared in a final volume of 20 μl containing 1 μl cDNAs and 10 μl of LightCycler 480 SYBR Green I Master (Roche ...
-
bioRxiv - Physiology 2024Quote: ... Signal intensity was captured using QuantStudio 3 qPCR system (Applied Biosystems) under the following conditions ...
-
bioRxiv - Plant Biology 2024Quote: qPCR was performed using QuantStudio 3 Real-Time PCR system (ThermoFisher) with PowerUp SYBR Green Master Mix (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Subsequent qPCR was performed on a Quant Studio 3 instrument (ThermoFisher), utilizing gene-specific PCR primers mixed with Power SYBR Green Master Mix (ThermoFisher ...
-
bioRxiv - Biophysics 2024Quote: ... The qPCRs were run using QuantStudioTM 3 system (Thermo Fisher Scientific) and the results collected with QuantStudioTM Design & Analysis Software (version 1.5.2 ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthesized using the env V1/V3 Primer ID primer (HXB2 positions 6585-7208): 5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNCAGTCCATTTTGCT CTACTAATGTTACAATGTGC-3’ and SuperScript III Reverse Transcriptase (Invitrogen). The final cDNA reaction contained the following ...
-
bioRxiv - Developmental Biology 2021Quote: ... We used the following Taqman primers from Thermo Fisher (Supplementary Table 3). 18S transcripts were used as the internal control and data were expressed using the 2−ddCt method with Ct limit of 40 ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from forebrain and brainstem of Tgf-β2+/+ and Tgf-β2-/- mice at E17.5 using TRIzol reagent (Invitrogen; Darmstadt, Germany) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... IL-1β secretion from PMA-THP1 was detected using IL-1 beta Human ELISA kit (#KHC0011, ThermoFisher Scientific) and IL-1 beta Human ELISA kit ...
-
bioRxiv - Molecular Biology 2022Quote: ... were PCR amplified from genomic DNA (Pf3D7) using gene-specific primer pairs (Table S1) with Phusion™ High-Fidelity DNA Polymerase (Thermo Scientific, US). The amplified DNA fragment was purified with QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Immunology 2020Quote: ... primer pairs were designed and used with 2 μl of cDNA and Fast SYBR Green PCR Master Mix (Applied Biosystems/Thermo Fisher Scientific) to detect the mRNA of EIF2AK3 (encoding PERK ...
-
bioRxiv - Immunology 2020Quote: ... primer pairs were designed and used with 2 μl of cDNA and Fast SYBR Green PCR Master Mix (Applied Biosystems/Thermo Fisher Scientific) to detect the mRNA of EIF2AK3 (encoding PERK ...
-
bioRxiv - Molecular Biology 2024Quote: T7 double stranded DNAs (T7-dsDNAs) were amplified by T7-tagged primer pairs (Table 2) by Phire Hot Start II PCR Master Mix kit (Thermo Fisher, Cat # F125L) using proper plasmids as templates ...
-
bioRxiv - Genetics 2024Quote: ... Triplicate reactions for each cDNA and primer pair were prepared in a MicroAmp Optical 384-well Reaction Plate (Thermo Fisher Scientific Cat. # 4309849), sealed with MicroAmp Optical Adhesive Film (Thermo Fisher Scientific Cat ...
-
bioRxiv - Microbiology 2020Quote: ... 0.1% beta-mercaptoethanol (Gibco) for 6 days at 37 °C and 9.5% CO2 ...
-
bioRxiv - Immunology 2021Quote: ... 50μM beta-mercapthoethanol (Gibco)) ...
-
bioRxiv - Immunology 2024Quote: ... 1X beta-mercaptoethanol (ThermoFisher), and 1X brefeldin A (BioLegend ...
-
bioRxiv - Cancer Biology 2023Quote: ... beta-mercaptoethanol (1X, Gibco), and 2% fetal bovine serum ...