Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for 5 M TOLYL FURAN 2 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... or 4°,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were added during the first wash step to visualize nuclei ...
-
bioRxiv - Immunology 2023Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (1 mg, Thermofisher, cat no: A10044) was injected intraperitoneally and mice were sacrificed after 2.5 h ...
-
bioRxiv - Cell Biology 2023Quote: ... mice received 50mg/kg 5-ethynyl-2’-deoxyuridine (EdU, Thermo Fisher) in PBS by intraperitoneal injection 24 hr before harvest ...
-
bioRxiv - Cancer Biology 2023Quote: ... 40 µM 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen, Waltham, MA, USA) was added to the cells ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated in 5-ethynyl-2’-deoxyuridine (EdU; ThermoFisher A10044) dissolved in K-SFM (20 mM final concentration ...
-
bioRxiv - Physiology 2024Quote: After loading with Fura-2 AM (5 μM, Invitrogen, F-1201), isolated sweat glands on coverslips were mounted in an open chamber and rinsed with standard bath solution containing (in mM) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and M-CSF (Invitrogen), as previously described (van Wilgenburg et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... 17.5ml M-199 (Invitrogen), 10ml Horse serum ...
-
bioRxiv - Microbiology 2020Quote: ... using M-MLV (Invitrogen) or Superscript IV (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... 0,018 M HEPES (Invitrogen) and 0.2 M NaOH to adjust pH to 7,4 ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.15 M NaCl (ThermoFisher), 25 mM EDTA (Sigma ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.01 M DTT (Invitrogen) and 150 U SuperScript® II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... M-MLV (Thermo Fisher), AMV (New England Biolabs) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 M HEPES (Gibco) and 1 % (v/v ...
-
bioRxiv - Bioengineering 2023Quote: ... + 10% M-CSF (Gibco), respectively ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Biochemistry 2022Quote: ... [M]+→[M-Py]+→ on a Orbitrap Elite high resolution mass spectrometer (ThermoFisher Scientific). In the MS mode resolution was 120,000 FWHM at m/z 400 with mass accuracy better than 5 ppm ...
-
bioRxiv - Cancer Biology 2021Quote: ... Reverse transcription was performed on 2 μg of total RNA using M-MLV Reverse transcriptase and random hexamers (Invitrogen). For PCR reactions ...
-
bioRxiv - Neuroscience 2020Quote: ... the primary microglia and M-MØP cells were then imaged using an EVOS FL Auto 2 onstage incubator system (Thermofisher). Images at x40 from cells in the 8 well chamber slide were taken every 30 minutes until the 2 hour mark ...
-
bioRxiv - Genetics 2021Quote: ... overnight at 4°C and then for 2 hours with Dynabeads M-280 Sheep Anti-Mouse IgG (Invitrogen 11201D). After 3 800uL washes in LiCl buffer (100mM Tris HCl pH 7.5 ...
-
bioRxiv - Immunology 2022Quote: ... CR3022-F(ab’)2 was buffer exchanged into the prepared 0.1 M sodium phosphate using Zeba columns (ThermoFisher, USA). DOTA-NHS-ester (#B-280 ...
-
bioRxiv - Cell Biology 2022Quote: ... iPSCs were transfected with PB-TO-hNGN2 vector (gift from M. Ward, NIH, Maryland) in a 1:2 ratio (transposase:vector) using Lipofectamine Stem (ThermoFisher); after 72 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 uL of RNA from each fraction were reverse-transcribed using 20U of M-MuLV Reverse Transcriptase (Thermo Scientific) and 0.3 ug of random hexamer primers in a reaction volume of 20 uL ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Each buffer mixture was then mixed with SeaKem®GTG agarose (2% m/v; Life Technologies, Gaithersburg, MD, USA) and gelled in a Petri dish so that the thickness of the gel layer was about 1 mm ...
-
kinesin recruitment by adapter SKIP on melanosomes is dynamically controlled by LC3B phosphorylationbioRxiv - Cell Biology 2021Quote: ... The tumor was excised and was washed in homogenization buffer (0.25 M sucrose [Merck, CAS 57–50–1], 10 mM HEPES, 1 mM EDTA, 2% antibiotic and antimycotic [ThermoFisher Scientific ...
-
bioRxiv - Genetics 2023Quote: ... The root (∼60 mg) was incubated for 2 h at 56°C with 950 μl 0.5 M EDTA pH 8.0 (Thermo Fisher), 50 μl 1% (w/v ...
-
Dose-dependent effects of histone methyltransferase NSD2 on site-specific double-strand break repairbioRxiv - Cell Biology 2023Quote: ... 2 μg of anti-NSD2 antibody (ab75359) and 20 μl of Dynabeads M-280 sheep anti-mouse IgG (Invitrogen) were mixed in immunoprecipitation dilution buffer and incubated for 6 h at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 μg of total RNA was reverse transcribed using random primers with M-MLC reverse transcriptase (Invitrogen, cat#28025021). Real-time PCR was conducted on Roche Lightcycler 96 Real time PCR system (Roche ...
-
bioRxiv - Neuroscience 2024Quote: Brains were dissected from 2-day old adults in PBS and incubated in 1.6 × 10-6 M acridine orange (ThermoFisher) for 5 min at room temperature ...
-
bioRxiv - Neuroscience 2019Quote: ... Cells were passaged 1:2-1:6 every 2-5 days by being rinsed once with DPBS (Gibco) and dissociated using 0.5 mM EDTA (75 μl/cm2 ...
-
bioRxiv - Microbiology 2024Quote: ... Propidium iodide (PI) and the pH sensitive 2’,7’-Bis-(2-Carboxyethyl)-5-(and-6)-Carboxyfluorescein (BCECF) (Invitrogen) were added to these at a final concentration of 100µM and 10µM respectively ...
-
bioRxiv - Microbiology 2020Quote: ... at which point the aqueous layer was removed and transferred to a new tube containing 100 μl of 5 M ammonium acetate (Ambion), 20 μl of 5 mg/ml glycogen (Ambion) ...
-
bioRxiv - Developmental Biology 2021Quote: ... at 5 m/s for 30 s with 1.4 mm ceramic beads (15-340-153, Fisher Scientific, Waltham, MA, USA). HH37 and older lower jaws were homogenized at 5 m/s for 60 s with 2.8 mm ceramic beads (15-340-154 ...
-
bioRxiv - Developmental Biology 2020Quote: ... at 5 m/s for 30 s with 1.4 mm ceramic beads (15-340-153, Fisher Scientific, Waltham, MA, USA). HH37 and older lower jaws were homogenized at 5 m/s for 60 s with 2.8 mm ceramic beads (15-340-154 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 200 ul of sample was taken out and 20 μl of 5 M NaCl and 10 μl of 10 mg/ml proteinase K (Invitrogen) was then added followed by an overnight incubation on 65°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were cross-linked for 15 minutes at room temperature with 1% formaldehyde and quenched for 5 mins at room temperature with 0.2 M glycine (Thermo Fisher). The cross-linked cells were aliquot (~ 3X106 cells ...
-
bioRxiv - Cell Biology 2022Quote: ... was cultured in a gelatin/fibronectin matrix (5 μg fibronectin / 0.02% gelatin (m/v)-Sigma) and Claycomb culture medium supplemented with Glutamax™ (Gibco), 10% (v/v ...
-
bioRxiv - Cancer Biology 2020Quote: BMDM were isolated from tibia of WT and Thbs4-/- mice as described by others (36) and in our previous publication (5) and cultured in M-CSF (14-8983-62, ThermoFisher)/DMEM/F12 for 5 days ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.1 M MgCl2, 0.1M Tris HCL, 1% Tx-100, 1x sBlock, 1% sodium deoxycholate, 5 units/mL DNAse I – Thermo Scientific #89836 ...
-
bioRxiv - Biochemistry 2021Quote: ... Pellets were dried for 20 min at room temperature then resuspended in 5 μL of 1 M Tris and 10 μL of protein loading buffer (2x NuPAGE LDS sample buffer (Invitrogen), 715 mM 2-mercaptoethanol) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Each acyl-CoA was quantified by the [M-507+H]+ product ion with a 5 ppm window with Tracefinder 4.1 (Thermo Scientific). Analysts were blinded to sample identity during sample preparation and analysis.
-
bioRxiv - Neuroscience 2024Quote: ... samples were diluted to 1 M urea with a mixture of 360 μL of 50 mM ammonium bicarbonate (17) and 5 μg of Trypsin (ThermoFisher). The samples were subsequently incubated overnight at 25 °C for digestion with trypsin ...
-
bioRxiv - Plant Biology 2023Quote: ... and the eluted chromatin was reverse-crosslinked by adding 20 ul 5 M NaCl and incubated at 65 °C overnight followed by treatment of Proteinase K (Invitrogen) for 4 hours at 45 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted in DPBS buffer (Dulbecco’s PBS 0,01 M + 0,2% BSA) and afterwards for another 30 minutes blocked with 5% Normal Goat Serum (Thermo Fisher Scientific) and 0,25% (0,2% for crypts ...
-
bioRxiv - Biochemistry 2024Quote: ... and 17 µL of 1x RNA Sequencing Buffer (20 mM sodium citrate pH 5, 1 mM EDTA, 7 M urea) (Ambion). The mixture was split across three tubes (9/8/8 µL) ...
-
bioRxiv - Biophysics 2021Quote: ... 5 % CO2 incubator for 5 hours before replacing the culture media with 2 mL B-DMEM (Thermofisher, cat. # 10566016) supplemented with 10 % FBS (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2021Quote: ... Samples were rinsed 2 times for 5 minutes with PBS++ and incubated with 5 drops of NucBlue (Life Technologies) for 10 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... A single bolus of 50μL 0.5% Texas-red dextran solution (70,000 MW, 5 mg/mL in 0.9% NaCl, t1/2 ∼ 25min, Termo Fisher Scientific) was injected ...
-
bioRxiv - Neuroscience 2023Quote: ... A 50μl bolus of 0.5% Texas-red dextran solution (70,000 MW, 5 mg/mL in 0.9% NaCl, t1/2 ∼ 25min, Termo Fisher Scientific) was injected at a constant rate of 30μl/sec using a syringe infusing pump (GenieTouch ...