Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for 4R 5S 2 5 Fluoropyridin 2 yl 4 5 diphenyl 4 5 dihydrooxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C in a 5% CO2 incubator with daily media changes and were passaged every 4-5 days using TrypLETM (ThermoFisher), following manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... Media was changed every second to third day and mucus clearance was performed every 4-5 days with 5 minutes apical PBS (ThermoFisher) incubation ...
-
bioRxiv - Cell Biology 2020Quote: ... or BODIPY™ 558/568 C12 (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Developmental Biology 2021Quote: Embryos and larvae from 9 hpf to 4 wpf were incubated in 3 µM 5-Ethynyl-2′-deoxyuridine (EdU; ThermoFisher Scientific, cat#: C10639) in FSW for 15-30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4ºC) and incubated with 50 μL of 5 μM DAF-FM (4-amino-5methylamino-2’,7’-dichlorofluorescein diacetate, Life Technologies, Eugene, OR, USA) diluted in 1X PBS for 30 min at 34 °C ...
-
bioRxiv - Cell Biology 2024Quote: Isolated CDX2mCherry cells (n=5) mCherry-negative cells (n=4) and hES cells (n=2 pooled) were centrifuged and 200uL Tri reagent (Thermo Fisher Scientific, USA) was added and incubated at room temperature for 15 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... siRNA (4): s35234 and siRNA (5): s35235 (Silencer Select, ThermoFisher Scientific, USA); EMC2 s18670 and EMC5 s41131 (Silencer Select ...
-
bioRxiv - Immunology 2021Quote: ... 2.5-5 µg was loaded onto a NuPAGE 4-12% gel (ThermoFisher) and run at 100V for 2-3 h ...
-
bioRxiv - Bioengineering 2023Quote: Samples were loaded with 5 μM Fluo-4 AM (ThermoFisher Scientific, Germany) in CM for 30 min in a cell culture incubator (37 °C and humidified 5% CO2) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and passaged every 4-5 days with 1 mg/ml dispase (Gibco).
-
bioRxiv - Cancer Biology 2022Quote: ... 5 ng/ml IL-4 (Thermo Fisher Scientific, Cat#14-8041-62) and 1 ng/ml TGF-β1 (Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2024Quote: ... and passaged every 4-5 days with 1 mg/ml Dispase (Gibco). The human FUSWT line ...
-
Upregulated GIRK2 counteracts ethanol-induced changes in excitability & respiration in human neuronsbioRxiv - Neuroscience 2024Quote: ... After 4-5 minutes 30 µM SCH-23390 (Fisher Scientific Cat#: 092550) in ACSF was applied for 1 minute ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and passaged every 4-5 days using StemPro Accutase (Thermo Fisher Scientific).
-
bioRxiv - Cancer Biology 2024Quote: ... and incubated overnight at 4° C with 5 mM MANT-GDP (Invitrogen). Excess nucleotide was removed using a GE FPLC using a HighPrep 26/10 column into a buffer containing 20 mM HEPES (pH 8.0) ...
-
bioRxiv - Cell Biology 2024Quote: ... 3-4 or 5-6 and Phusion DNA polymerase (Thermo Fisher Scientific). The resulting PCR mix was DpnI digested and 4 μl of the mix was used for transformation of E ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-5×106 cells were resuspended in 100 μL of DMEM (Invitrogen) and 4 μg of plasmid DNA ...
-
bioRxiv - Biophysics 2021Quote: ... 5 % CO2 incubator for 5 hours before replacing the culture media with 2 mL B-DMEM (Thermofisher, cat. # 10566016) supplemented with 10 % FBS (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2021Quote: ... Samples were rinsed 2 times for 5 minutes with PBS++ and incubated with 5 drops of NucBlue (Life Technologies) for 10 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... A single bolus of 50μL 0.5% Texas-red dextran solution (70,000 MW, 5 mg/mL in 0.9% NaCl, t1/2 ∼ 25min, Termo Fisher Scientific) was injected ...
-
bioRxiv - Neuroscience 2023Quote: ... A 50μl bolus of 0.5% Texas-red dextran solution (70,000 MW, 5 mg/mL in 0.9% NaCl, t1/2 ∼ 25min, Termo Fisher Scientific) was injected at a constant rate of 30μl/sec using a syringe infusing pump (GenieTouch ...
-
bioRxiv - Cell Biology 2023Quote: ... for 2–5 h at 37°C followed by a 5 min incubation in TrypLE express (Thermo Fisher Scientific) to generate small clumps of corneal endothelial cells ...
-
bioRxiv - Pathology 2024Quote: ... according to manufacturer specifications in the presence of 10mM 5-Bromo-2’-Deoxyuridine 5’-Triphosphate (BrdUTP, Thermo Scientific, B21550), at 37°C in a dark humidified slide box for 90 minutes ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... discoideum clones on SM/5 plates (2 g glucose (Fisher Scientific), 2 g Bacto Peptone (Oxoid) ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (Click-iT Plus EdU Kit, Invitrogen) and 5-bromo-2’-deoxyuridine (BrdU ...
-
bioRxiv - Cell Biology 2020Quote: ... Twenty min before fixation EdU (5-ethynyl-2’-deoxyuridine, Molecular probes) was added in all the experiments ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2×10^5 cells were lysed in RIPA buffer (Thermo Fisher) with protease and phosphatase inhibitors (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were incubated with EdU (5-ethynyl-2’-deoxyuridine, Life technologies) at final concentration of 10 µM for 4 hours and then harvest to perform Click-iT reaction using Click-iT EdU flow cytometry Alexa Fluor 488 assay kit (Life technologies ...
-
bioRxiv - Genomics 2022Quote: ... supplemented with 5 mM MgCl2 and 2% penicillin–streptavidin (Gibco, #15140122). Minced tissue was digested with enzyme solution at 37°C for 60-90 min with gentle shaking ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 µM 5-ethynyl-2′-deoxyuridine (EdU) (Invitrogen, Carlsbad, CA, USA); 10 µM 5-bromo-2’-deoxyuridine (BrdU ...
-
bioRxiv - Genomics 2022Quote: ... supplemented with 5 mM MgCl2 and 2% penicillin–streptavidin (Gibco, #15140122). Tissue was incubated with enzyme solution for 30 min at 37°C with gentle shaking ...
-
bioRxiv - Neuroscience 2021Quote: ... pH 7.4) supplemented with 5 μM Fura-2 AM (Thermo Fisher), 50 μM pluronic acid F-127 (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... 2% B-27 supplement and 5% fetal bovine serum (Invitrogen, Canada) plus 1/3 of minimum essential medium enriched with 1% penicillin/streptomycin ...
-
bioRxiv - Cancer Biology 2023Quote: ... 40 µM 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen, Waltham, MA, USA) was added to the cells ...
-
bioRxiv - Plant Biology 2024Quote: ... respectively were stained with EdU (5-ethynyl-2′-deoxyuridine; Thermo Fisher) and modified pseudo-Schiff propidium iodide (PI ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNAs targeting DHHC 2 and 5 were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Plant Biology 2024Quote: For combined 5-ethynyl-2-deoxyuridine (Invitrogen A10044, Thermo Fisher Scientific) and modified pseudo-Schiff-propidium iodide (PI ...
-
bioRxiv - Plant Biology 2024Quote: For combined 5-ethynyl-2-deoxyuridine (Invitrogen A10044, Thermo Fisher Scientific) and modified pseudo-Schiff-propidium iodide (PI ...
-
bioRxiv - Immunology 2023Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (1 mg, Thermofisher, cat no: A10044) was injected intraperitoneally and mice were sacrificed after 2.5 h ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated in 5-ethynyl-2’-deoxyuridine (EdU; ThermoFisher A10044) dissolved in K-SFM (20 mM final concentration ...
-
bioRxiv - Physiology 2024Quote: After loading with Fura-2 AM (5 μM, Invitrogen, F-1201), isolated sweat glands on coverslips were mounted in an open chamber and rinsed with standard bath solution containing (in mM) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of 5× SYPRO orange (Life Technologies, Eugene, Oregon, USA) and 2.5 µl of the resuspended array compound or the equivalent amount of buffer in the ligand-free control ...
-
bioRxiv - Systems Biology 2024Quote: ... 2) Blocking buffer: wash buffer with 5% BSA (Thermo Fisher, J6509722). Hs27-VPH were transduced with lentiviruses of pRCA360 expressing sgRNA against HES7 ...
-
bioRxiv - Cancer Biology 2024Quote: ... incubated with 5-ethynyl-2′-deoxyuridine (EdU) (Thermo Fisher Scientific, C10636), then stained with a fluorescent CD34 antibody ...
-
bioRxiv - Cell Biology 2024Quote: ... transferred to 5 mL of LB broth (Fisher Scientific, BP1426-2), and incubated shaking overnight at 37℃ ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μL of 10 mM NBD-(linezolid-7-nitrobenz-2-oxa-1,3-diazol-4-yl)-amino-D-alanine (NADA) (Thermo Fisher) was added to each tube and incubated at 37° C ...
-
bioRxiv - Biochemistry 2021Quote: ... with a 10-fold excess of N,N’-dimethyl-N-(iodoacetyl)-N’-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) ethylenediamine (IANBD-amide, Molecular Probes). After 90 min on ice ...
-
bioRxiv - Biophysics 2022Quote: ... N-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)-1,2-Dihexadecanoyl-sn-Glycero-3-Phosphoethanolamine (NBD-PE) was purchased from ThermoFisher (Waltham, MA). Cholesterol Oxidase from Streptomyces was purchased from MP Biomedicals (Santa Ana ...
-
bioRxiv - Microbiology 2023Quote: Epimastigotes and trypomastigotes lysates containing 2 x 107 parasites in 20 µL of SDS-PAGE sample buffer containing 5 mM DTT were boiled for 5 min and loaded onto precast Novex Value 4-12% Tris-Glycine gels (Thermo Fisher). The electrophoresis was performed in 50 mM MOPS-50 mM Tris Base ...