Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 4R 5S 2 5 Fluoropyridin 2 yl 4 5 diphenyl 4 5 dihydrooxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... A 3% agarose gel with 4 μL ethidium bromide was loaded with 5 μL PCR reaction and 2 μL GeneRuler 100bp ladder Plus (Thermo Fisher) and run for 40 minutes at 100 volts ...
-
bioRxiv - Microbiology 2023Quote: For detection of NO in treated mycobacteria DAF-FM diacetate (4-Amino-5-Methylamino-2’,7’-Difluorofluorescein),27 purchased from Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... and counterstained with 5 μg/mL of 4′,6-diamidino-2-phenylin-dole (DAPI) or propidium iodide (Molecular Probes, Life Technologies) for 10 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... and counterstained with 5 μg/mL of 4′,6-diamidino-2-phenylin-dole (DAPI) or propidium iodide (Molecular Probes, Life Technologies) for 10 min ...
-
bioRxiv - Bioengineering 2023Quote: ... Hydrogels were washed extensively with PBS and activated via photoirradiation (365 nm, 0.8 mW for 5 minutes) with sulfosuccinimidyl-6-4’-azido-2’-nitrophenylamino hexanoate (Sulfo-SANPAH; Thermo Scientific Pierce). To do so ...
-
bioRxiv - Cell Biology 2022Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes). Cells were imaged using a DeltaVision Ultra microscope with a 60X objective (NA = 1.42) ...
-
bioRxiv - Immunology 2024Quote: ... For T cell panels (Supplemental table 2, 4, 5, 6) we fixed cells with the FOXP3 Fixation/Permeabilization Buffer Kit (Thermo Fisher) and conducted intracellular/nuclear stains using the FOXP3 Permeabilization Buffer (Thermo Fisher ...
-
bioRxiv - Genomics 2024Quote: ... was prepared fresh with the 3’aminated 5’ caged oligo root carrying a terminal Cy3 dye (2 μM BL003 for the single-cycle experiment and 2 μM BL728 for the 4-cycle experiment) and a bifunctional crosslinker BS(5)PEG (Thermo Scientific) (5 μM in dimethylformamide) ...
-
bioRxiv - Microbiology 2024Quote: ... 20% volume of 1M 2-morpholin-4-ylethanesulfonic acid (MES) pH 5 and Immobilized Protein G resin (Thermo Scientific Prod#20397) were added to supernatant and sample was incubated overnight at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... blotted 5s with blot force 5 after 60s incubation in a Vitrobot IV (Thermo Fisher) at 6 °C using 100% humidity and flash-frozen in liquid ethane.
-
bioRxiv - Neuroscience 2024Quote: ... After 4 times 5-minute washes in PBS with 0.5 % Tween® 20 (Fisher Scientific #9005-64-5), each slide was again dried around tissue slices and PAP pen was re-applied ...
-
bioRxiv - Cell Biology 2024Quote: ... Stage 4/5 hippocampal neurons (5-11 DIV respectively) were transfected with Lipofectamine 2000 (Thermo Fisher, Cat# 11668019) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... HSPCs were incubated with 20µM NBD C6-Ceramide (6-((N-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)amino)hexanoyl)Sphingosine) (Invitrogen) for 30 minutes at 4°C for Golgi staining or Cytopainter (Abcam ...
-
bioRxiv - Cancer Biology 2021Quote: ... Excess cells were washed off with PBS (4×5 mL, Gibco), briefly left in RPMI (5 mL ...
-
bioRxiv - Neuroscience 2021Quote: ... The cells were loaded with 5 μM fluo-4 AM (Invitrogen) in Hanks’ balanced salt solution (HBSS ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-5 μl Page Ruler Pre-stained Protein Ladder (Thermo Scientific), and 10 μl of 4X Dye (last three grooves ...
-
bioRxiv - Cancer Biology 2024Quote: ... Excess cells were washed off with PBS (4×5 mL, Gibco), briefly left in RPMI (5 mL ...
-
bioRxiv - Microbiology 2024Quote: ... 4 µl of T4 DNA ligase (Thermo Fisher, 5 WU/µl) was added ...
-
bioRxiv - Immunology 2022Quote: The production of NO was evaluated using 4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate (DAF-FM DA)(D23844; Invitrogen, Waltham, MA). Following leukocyte isolation ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were then washed 4-5 times in PBS for 2 hours and mounted onto glass slides using ProLong Gold Antifade Mountant (Invitrogen; Cat #P36930). Sections were imaged on a Leica SP8 upright confocal laser scanning microscope using a X10/NA 0.45 objective ...
-
bioRxiv - Microbiology 2023Quote: The RBDs of G614, Alpha, Beta, and Omicron (BA.1, BA.2, BA.4/5) variants were ordered as GeneString from GeneArt (Thermo Fisher Scientific). All sequences of the RBD (aa 319-541 in GenBank ...
-
bioRxiv - Physiology 2023Quote: ... and incubated for a period of 1 h in a dark room in 2 ml of extracellular solution containing 5 µM fluo- 4 AM (Thermo Fisher Scientific) or 7 µM Corona Green AM (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... After the secondary antibody was washed three times for 5 min, nuclei were stained with DAPI (4’,6- Diamidino-2-Phenylindole, Dihydrochloride) (#D1306, Thermo Fisher Scientific) (dilution 1:1,000 in PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 5% Fetal Bovine Serum (FBS), 4°C) and incubated (37°C, 2 minutes) in protease solution (TrypLE express, Thermo Fisher 12604013) supplemented with DNase (100 U/ml ...
-
bioRxiv - Physiology 2024Quote: ... sections were incubated for 5 min with 4’,6-diamidino-2-phenylindole, dihydrochloride (DAPI, Dojindo, D523) and then mounted with PermaFluor (Thermo Fisher Scientific). Images were acquired using a BC43 or LSM800 instrument equipped with a Zeiss Axio Observer Z1 and a LSM 800 confocal unit with Airyscan module ...
-
bioRxiv - Molecular Biology 2024Quote: ... 200 μl of cells were collected by centrifugation at 1500 rpm for 5 min at 4°C and stained with anti-SARS-CoV-2 RBD antibody (Invitrogen, PA5-114529). After centrifugation ...
-
bioRxiv - Immunology 2024Quote: ... Cell concentrations were assessed by acquiring 30 μL of resuspended cells diluted 1:5 in PBS-4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific) without any prior washing steps ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 to 4 µL was injected onto an Acclaim PepMap 100 column packed with 2 cm of 5 µm C18 material (Thermo Fisher, 164564) using 0.1% formic acid in water (solvent A) ...
-
bioRxiv - Cell Biology 2024Quote: Cells (2 – 5 x 106) were washed two times with cold PBS and lysed with RIPA buffer at 4°C (Thermo Fisher Scientific) supplemented with protease inhibitor (Roche ...
-
bioRxiv - Cancer Biology 2024Quote: ... Above cells were split every 4-5 days using 5-10-minute incubation with 0.05% trypsin-EDTA (Thermo Fisher) at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... centrifuged at 5 000×g for 5 min at 4°C in SpinX 0,2 µm tubes (Corning, Fisher Scientific) for cell debris and bacterial removal ...
-
bioRxiv - Cell Biology 2022Quote: ... 200µL 5-Ethynyl-2’-deoxyuridine (EdU, Molecular probes; 3g/L) was injected intraperitoneally in pregnant females 2 hours before embryo isolation.
-
bioRxiv - Developmental Biology 2020Quote: ... and 5.5 x 10-5 mol/L 2-mercaptoethanol (Gibco). For the endothelial potential assay ...
-
bioRxiv - Cell Biology 2020Quote: ... For 5-ethynyl-2’-deoxyuridine (EdU) incorporation assays (Life Technologies), 10μM EdU was included in culture for two hours ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5-ethynyl-2′-deoxyuridine (EdU) (Thermo Fisher Scientific, cat. #E10415) was diluted 2.5 mg/ mL in sterile PBS and injected intraperitoneally on days 3 and 4 post-injury at a dose of 10 μL/ g body weight ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU; Thermo Fisher Scientific, Waltham, MA) was either injected i.p ...
-
bioRxiv - Cancer Biology 2022Quote: ... or 2 - 5 μg/ml Puromycin Dihydrochloride (Thermo Fisher, # A1113803) until all negative control cells were dead ...
-
bioRxiv - Microbiology 2022Quote: ... or 0.1 mM 5-ethynyl-2’-deoxyuridine (EdU; Life Technologies) was added for the time indicated in the text.
-
bioRxiv - Cancer Biology 2022Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (Thermo Fisher Scientific, Barcelona, Spain) was added for 48h ...
-
bioRxiv - Immunology 2021Quote: ... 5 μM of 2′,7′-Dichlorofluorescin diacetate (DCFH-DA, Invitrogen) probe was added to each neutrophil subtype and incubated in the dark for 15 min ...
-
bioRxiv - Biophysics 2020Quote: ... while GRN-5 was expressed in Origami 2 DE3 (Invitrogen) as fusion constructs with a thioredoxin-A and hexa-histidine tag (TrxA-Hisx6-GRN) ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 ml of bovine collagen I (5 mg/ml) (Gibco), and 6.67 ml serum starvation medium were mixed on ice ...
-
bioRxiv - Cell Biology 2020Quote: ... For pulsed EdU (5-ethynyl-2’-desoxyuridine) (Thermo Fisher Scientific) incorporation ...
-
Evolutionary conservation of maternal RNA localization in fishes and amphibians revealed by TOMO-SeqbioRxiv - Developmental Biology 2021Quote: ... and 2 μl of 5 × First strand synthesis buffer (Invitrogen) were added and incubated ...
-
bioRxiv - Cell Biology 2021Quote: ... 6 - diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µL TaqMan Universal PCR Master Mix (2×) (Applied Biosystems), and 0.5 µL of each TaqMan Gene Expression Assay reagent ...
-
bioRxiv - Physiology 2022Quote: ... loading buffer containing 5% 2-mercaptoethanol (Fisher Scientific, O3446I-100). Samples were then subjected to SDS-PAGE on NuPAGE Novex 12% Bis-Tris gels (Invitrogen ...
-
bioRxiv - Bioengineering 2022Quote: ... 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) (16:0 NBD) were purchased from Invitrogen. Phosphate-buffered saline (PBS ...
-
DeFrND: detergent-free reconstitution into native nanodiscs with designer membrane scaffold peptidesbioRxiv - Biophysics 2024Quote: ... N,N’-Dimethyl-N-(Iodoacetyl)-N’-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)Ethylenediamine (IANBD amide) and Oregon GreenTM 488 (OG) maleimide were obtained from ThermoFisher. All other chemicals were acquired from Sigma.
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...