Labshake search
Citations for Thermo Fisher :
2901 - 2950 of 10000+ citations for 6 Methyl 2 3 4 9 tetrahydro 1H carbazol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... and one guide sequence (Table 1) was generated by following the MEGAscript®Kit (Invitrogen) protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were stained for one hour with phalloidin Alexa fluor 488 (1:300, ThermoFisher, A12379) or phalloidin Alexa fluor 568 (1:300 ...
-
bioRxiv - Genomics 2024Quote: ... one third of the vegetative stage cells were resuspended in 1 ml TRIzol Reagent (Invitrogen) and stored at −20°C until further processing ...
-
bioRxiv - Microbiology 2023Quote: ... RNA quality was verified by 1% agarose electrophoresis and quantified using Nanodrop One (Thermo Scientific). As control ...
-
bioRxiv - Molecular Biology 2024Quote: ... and checked on 1% agarose gel and concentration measured with a NanoDrop One spectrophotometer (ThermoFisher). Double-stranded RNA targeting the gene encoding the green fluorescent protein (dsGFP ...
-
Efficient Suppression of Endogenous CFTR Nonsense Mutations Using Anticodon Engineered Transfer RNAsbioRxiv - Molecular Biology 2021Quote: ... one-step reverse transcriptase and quantitative PCR (RT-qPCR) was performed on the QuantStudio 3 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) using the Luna Universal One-Step RT-qPCR Kit (New England BioLabs ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5’ TCTCGCTGGGGACTCTGGTTGAAAT 3’) primers (Eurofins, Louisville, KY) and SuperScript™ III One-Step RT-PCR kit with Platinum™ Taq DNA Polymerase (Invitrogen, Carlsbad, CA) using the following thermocycler conditions ...
-
bioRxiv - Neuroscience 2024Quote: ... 20 ng/mL Interleukin-6 (IL-6) (Thermo Fisher Scientific), 20 ng/mL Interleukin-3 (IL-3 ...
-
bioRxiv - Genetics 2020Quote: ... Cells were seeded in 6-well plates and transfected with 4 μg/well vectors expressing CasRx-GFP and gRNAs-mCherry (CasRx:gRNA-1:gRNA-2 = 2:1:1, see Supplementary sequences) using Lipofectamine 3000 reagent (Thermo Fisher Scientific). Control group was only transfected with 2 μg/well vectors containing CasRx-GFP ...
-
bioRxiv - Neuroscience 2019Quote: ... Abcam ab13970, γH2A.X 1:500, Sigma Aldrich 05-636; Map-2 1:250, Sigma Aldrich M4403; Map-2 1:250, Invitrogen PA517646 ...
-
bioRxiv - Genetics 2021Quote: ... containing a 4:1:1 mixture of Lipofectin transfection reagent (ThermoFisher Scientific), water and BAC DNA (~ 15 μg DNA per larva) ...
-
bioRxiv - Biophysics 2021Quote: ... The filtered lysate was diluted 1:2 in purification buffer UA (8 M Urea, 50 mM sodium acetate [Acros Organics, Carlsbad, CA], pH 4). The protein was then purified using a cation exchange HiPrep SP HP 16/10 (Cytiva ...
-
bioRxiv - Cell Biology 2021Quote: ... permeabilized with 0.1% Triton X-100 in PBS for 10 min and blocked with 2% BSA solution in PBS for 1 h followed by overnight incubation at 4°C with primary antibodies diluted in 2% BSA blocking solution: mouse monoclonal [1F7G5] anti-CKS2 (1:100 dilution; Thermo Fisher Scientific; 37-0300), rabbit polyclonal anti-P63 (p63α ...
-
bioRxiv - Biophysics 2021Quote: ... Infrared exposure levels for INS were selected based on their ability to elicit dynamic calcium responses (>2% increase, dF/F) in NG108 cells loaded with a calcium dye (Fluo-4-AM at 1 μM, ThermoFisher, St. Louis, MO, USA). Radiant exposures for no stimulation ...
-
bioRxiv - Neuroscience 2022Quote: ... The sections were then incubated for 2 h at 4℃ with Alexa fluor 488-conjugated secondary antibody (1:200, Invitrogen, #A21206, Carlsbad, CA, USA) or DAPI (1:30000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... CKY2038 was grown to mid-log (1-2×107 cells/mL) in SC liquid media and added to the ConA treated perfusion chamber gasket (ThermoFisher, 4 chamber: 19 × 6mm) for treatment at indicated conditions (SC+1% DMSO ...
-
bioRxiv - Cell Biology 2020Quote: ... pGWB610 and pGWB633 (9) using LR Clonase II (Thermo Fisher Scientific) to generate pFLOE1p:FLOE1-GFP ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cells were cultured for 9 days with DMEM (Thermo Fisher), 20% fetal bovine serum (Thermo fisher) ...
-
bioRxiv - Bioengineering 2020Quote: ... 9 mL of DMEM/F12 media supplemented with 20% FBS (GIBCO) was added and cells were centrifuged at 300 RCF for 3 m ...
-
bioRxiv - Neuroscience 2021Quote: ... and JC-9 Dye (Mitochondrial Membrane Potential Probe) (ThermoFisher Cat# D22421) were purchased from Invitrogen (Carlsbad ...
-
bioRxiv - Developmental Biology 2022Quote: ... 9 mL of DMEM/F12 medium supplemented with 20% FBS (GIBCO) was added for neutralization and TrypLE Express washing ...
-
bioRxiv - Microbiology 2020Quote: ... The bacterial cells were stained with 5 μM Syto 9 (Invitrogen) and fungal cells were counter-stained with 2 μg/mL calcofluor white (Fluka ...
-
bioRxiv - Cell Biology 2019Quote: ... Sf-9 cells were transfected with isolated bacmids using Cellfectin (ThermoFisher), and after 4 days ...
-
bioRxiv - Genomics 2020Quote: ... were transferred using 9 μl Lipofectamine RNAi MAX Reagent (Invitrogen, USA). The cell migration and invasion capacity of Harbi1 on HUVECs cells were determined by transwell insert chambers (Corning ...
-
bioRxiv - Microbiology 2021Quote: ... Parasites were grown In vitro in HMI-9 medium (Life technologies) [21] at 37°C 5% CO2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The sequences were analyzed using Vector NTI Advance 9 software (Invitrogen) [26-27].
-
bioRxiv - Bioengineering 2022Quote: ... 9 mL of DMEM/F12 medium supplemented with 20% FBS (GIBCO) was added for neutralization and TrypLE Express washing ...
-
bioRxiv - Cancer Biology 2022Quote: ... CD7/APC (clone GP40 [Leu-9], Invitrogen, cat. 17-0079-42), Fixable Viability Stain 700 (BD Biosciences ...
-
bioRxiv - Molecular Biology 2023Quote: ... at 9×103 cells/well and cultured in DMEM (Gibco, 11965118) with 10% FBS (Gibco ...
-
bioRxiv - Physiology 2023Quote: ... cell nuclei were stained with 9 μM Hoechst 33342 (Invitrogen, H3570) for 10 min ...
-
bioRxiv - Neuroscience 2023Quote: ... neurons were transfected at DIV 9-16 by Lipofectamine 2000 (Invitrogen) according to the manufacturer’s manual ...
-
bioRxiv - Cell Biology 2023Quote: ... Nuclei were counterstained with 5 μM of SYTO 9 Green (Invitrogen) for 10 minutes on ice ...
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with 9 % v/v Fetal Bovine Serum (FBS) (Gibco, #10270106), 2 mM L-Glutamine (Gibco ...
-
bioRxiv - Neuroscience 2023Quote: ... after which 9 ml Essential 8 medium (Thermo Fisher Scientific, A1517001) was added to the well for resuspension ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were incubated in Gibco ™ LHC-9 medium (Thermo Fisher) and kept incubated at 37 °C and 5% CO2 until they reached the desired confluence ...
-
bioRxiv - Cancer Biology 2023Quote: ... mounted with fluorescence mounting medium (9 ml of glycerol [Fisher Scientific cat#BP229-1] ...
-
bioRxiv - Cancer Biology 2024Quote: ... Each plasmid was mixed with 9 μL of Lipofectamine2000 (Invitrogen, UA) and incubated for 20 minutes at room temperature before being transferred into the growth medium ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 9 hpi with the fluorometer Fluoroskan Ascent FL (Thermo Fisher). Each measure was compared with the values obtained at 0 hpi.
-
bioRxiv - Cell Biology 2024Quote: ... and 5 μg LentiCRISPRv2blasti hcaspase-9 using Lipofectamine 2000 (Life Technologies). The following day the medium was changed to fresh medium containing 20% FBS ...
-
bioRxiv - Neuroscience 2021Quote: ... and then incubated for 2 h at room temperature with one of the species-matching conjugated secondary antibodies (all from ThermoFisher Scientific): goat anti-mouse Alexa-Fluor 555 (cat ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR (SARS-CoV-2 and MS2 viral genome detection) were performed with the Express one step RT-qPCR Universal kit (ThermoFisher Scientific) using 3.5µL of RNA and 6.5µL of RT-qPCR mix that contains 250nmol of each primer and 75nmol of probe ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The final pooled library was diluted to an appropriate concentration and then subjected to Ion Sphere Particle (ISP) emulsion PCR amplification using an Ion One Touch 2 and an Ion PI Template OT2 200 Kit (Life Technologies). We sequenced the final library in two runs on an Ion Torrent Personal Genome Machine (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... One half of each tissue sample was homogenised in 1ml DMEM medium containing 2% FBS supplemented with Penicillin/Streptomycin (Gibco, USA) for 5min at 30Hz using a Tissue Lyser II (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 nucleoprotein cDNA was generated from RNA from Bei Resources (NR-52285) by One-Step RT PCR (SuperScript IV, Thermo Fisher) with primers SARS CoV-2 N IVT F1 (5’-GAATTCTAATACGACTCACTATAGGGGATGTCTGATAATGGACCC-3’ ...
-
bioRxiv - Biochemistry 2021Quote: ... The protein was run over either one (at 10°C) or two (at 10°C and 2°C) immobilized pepsin columns (Applied Biosystems; Poroszyme Immobilized Pepsin Cartridge ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 nucleoprotein cDNA was generated from RNA from Bei Resources (NR-52285) by One-Step RT PCR (SuperScript IV, Thermo Fisher) with primers SARS COV-2 N IVT F1 (5’-GAATTCTAATACGACTCACTATAGGGGATGTCTGATAATGGACCC-3’ ...
-
bioRxiv - Immunology 2021Quote: ... and the SARS-CoV-2 spike gene was reverse-transcribed and amplified with a SuperScript IV One-Step RT-PCR kit (ThermoFisher Scientific) using primers flanking the S gene ...
-
bioRxiv - Bioengineering 2023Quote: ... mRNA was co-transcriptionally capped using m7(3’OMeG)(5’)ppp(5’)(2’OMeA)pG capping reagent (Hongene Biotech) in a “one-pot” reaction followed by digestion with DNase I (Thermo Fisher). Linear mRNA was purified using Dynabeads MyOne Carboxylic Acid beads (Thermo Fisher).
-
bioRxiv - Molecular Biology 2023Quote: Cas12a-gRNA ribonucleoprotein complexes containing one sgRNA targeting the vault1-2 gene (TTTAGCTCAGCGGTTACTTCGAGTACA) were nucleofected in HEK293T using Neon Transfection System (Thermo Scientific). After 48 hours cells were single-cell sorted into 96-well plates and subsequently genotyped ...
-
bioRxiv - Biochemistry 2023Quote: ... The temperature was increased from 5 °C to 95 °C over 2 hours and readings taken using a One Step Plus RT-PCR (Applied Biosystems).