Labshake search
Citations for Thermo Fisher :
2751 - 2800 of 10000+ citations for hsa mir 23b Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... was performed and analysed on StepOnePlusTM real-time PCR system (Applied Biosystems). FLSMN2 and Total SMN2 transcripts were amplified using gene-specific primers (Table S1)(62) ...
-
bioRxiv - Neuroscience 2021Quote: ... and run on a QuantStudio 3 Real Time PCR System (Applied Biosystems). mRNA expression levels were normalized to the expression level of chicken 18S ribosome (Himmels et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... on a QuantStudio™ 6 Flex Real-Time PCR System (Applied Biosystems). Transcript levels were analyzed using the delta delta Ct method and GAPDH was used as an internal control (110) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and quantification by the Step One Real-time PCR system (Applied Biosystems). RT2 lncRNA PCR assays (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: Amplification data were exported from QuantStudio Real-Time PCR Software (ThermoFisher Scientific) into Excel (version 16.0.11325.20156 ...
-
bioRxiv - Immunology 2022Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific). Fam49b primers were forward ...
-
bioRxiv - Immunology 2022Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific). Fam49b primers were forward ...
-
bioRxiv - Microbiology 2020Quote: ... in a QuantStudio 6 Flex Real-Time PCR system (Applied Biosystems, USA). The standard curve was constructed using RNA from SARS-CoV-2 infected Vero E6 cells ...
-
bioRxiv - Genomics 2020Quote: ... and the StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA). RNA samples were multiplexed at a sequencing depth of five libraries per lane ...
-
bioRxiv - Molecular Biology 2021Quote: ... on a QuantStudio™ 5 Real-Time PCR System machine (ThermoFisher Scientific). Each value was normalized by the corresponding input chromatin sample ...
-
bioRxiv - Molecular Biology 2019Quote: ... qPCR was performed on a StepOnePlus real time PCR system (Applied Biosystems) using SYBR Green Mastermix (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: We used QuantStudio Real-Time PCR Software version 1.3 (Thermo Fisher Scientific) for data analysis ...
-
bioRxiv - Neuroscience 2019Quote: ... and the the QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). Specific amplification was determined by melt curve analysis and agarose gel electrophoresis of the PCR products ...
-
bioRxiv - Physiology 2019Quote: ... on a Viia7 Real-Time PCR system (Life Technologies/Thermo Fisher Scientific), and normalized to 18S rRNA signals ...
-
bioRxiv - Physiology 2019Quote: ... on a Viia7 Real-Time PCR system (Life Technologies/Thermo Fisher Scientific), and normalized to 18S rRNA signals ...
-
bioRxiv - Pathology 2019Quote: ... and the QuantStudio3 Real-Time PCR System (Thermo Fisher, Whaltam, MA, USA) as previously described (Aquilano et al. ...
-
bioRxiv - Physiology 2019Quote: Using the StepOnePlus Real-time PCR System (Applied Biosystems, Waltham, MA, USA) and SYBR Green ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Data were acquired using a Quantstudio3 Real-Time PCR System (Applied Biosystems) using the following conditions ...
-
bioRxiv - Physiology 2020Quote: ... using an Applied Biosystems QuantStudio 3 real-time PCR system (ThermoFisher Scientific) as we previously described 66 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and deposited in a 7900HT Fast Real-Time PCR system (Applied Biosystems) to perform first strand cDNA synthesis (temperature program ...
-
bioRxiv - Microbiology 2019Quote: Amplification was measured on a StepOnePlus Real-Time PCR System (Applied Biosystems). Quantification of gDNA abundance relative to the standard curve was performed using the ΔCT method.
-
bioRxiv - Physiology 2020Quote: ... cDNA was amplified by real-time PCR using SYBR Green (Applied Biosystems) detection with specific primers for the gene of interest ...
-
bioRxiv - Molecular Biology 2019Quote: ... using the QuantStudio™ 7 Flex Real-Time PCR System (Life Technologies). ESRP1 was detected using (ESRP1 for AGCACTACAGAGGCACAAACA ...
-
bioRxiv - Bioengineering 2021Quote: ... in an Applied Biosystems StepOnePlus Real-Time PCR Machine (Thermo Fisher Scientific). Commercial primer pairs were used for GJA1 (Bio-Rad ...
-
bioRxiv - Genetics 2020Quote: ... on an Applied Biosystems 7500 Real-time PCR System (Thermo Fisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... STEP ONE PLUS Real Time PCR system (Applied Biosystems Japan, Tokyo, Japan), SYBR GREEN PCR Master Mix (Applied Biosystems Japan ...
-
bioRxiv - Microbiology 2020Quote: ... analyzed on a 7900HT Fast Real-Time PCR System (4329003; Thermofisher Scientific). Virus titer was determined as described above.
-
bioRxiv - Cancer Biology 2020Quote: ... and monitored using a StepOne® Real-Time PCR system (Applied Biosystems). Each sample was analysed in triplicate and mRNA levels normalised to β-actin.
-
bioRxiv - Microbiology 2021Quote: ... using the ABI7500 Real-Time PCR System (Applied Biosystems, Foster City, CA). Amplification plots were generated ...
-
bioRxiv - Immunology 2021Quote: ... Real-time PCR was performed with an ABIPRISM 7500 instrument (Applied Biosystems) using SYBR Green PCR Core Reagents (Applied Biosystems) ...
-
bioRxiv - Immunology 2021Quote: ... were analyzed on a 7500 Fast Real-time PCR System (Applied Biosystems). The comparative Ct method was used to determine the relative mRNA expression of genes normalized by the housekeeping gene GAPDH ...
-
bioRxiv - Immunology 2021Quote: ... and run on a QuantStudio5 Real-Time PCR System (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2021Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g.
-
bioRxiv - Microbiology 2021Quote: ... Real-time PCR was performed on generated cDNA with SYBER Green (Invitrogen) using QuantStudio 6 Flex Real-Time PCR System ...
-
bioRxiv - Cell Biology 2020Quote: ... on a 7500 Fast Real-time PCR system (Applied Biosystems/Life Technologies). Ribosomal RNA (18S ...
-
bioRxiv - Cell Biology 2020Quote: ... on a 7500 Fast Real-time PCR system (Applied Biosystems/Life Technologies). Ribosomal RNA (18S ...
-
bioRxiv - Bioengineering 2020Quote: ... Real time PCR reaction was performed in Applied Biosystems qPCR machine (Thermofisher). Total reaction was 10 μl for each gene in triplicates with thermocycler conditions as ...
-
bioRxiv - Bioengineering 2020Quote: ... Real-time PCR was performed using TaqMan Universal Master Mix II (ThermoFisher) along with the following TaqMan primers ...
-
bioRxiv - Bioengineering 2020Quote: ... Real-time PCR was performed using the StepOnePlus thermocycler (Applied Biosystems, CA) and SYBR Green Reaction Mix (Applied Biosystems ...
-
bioRxiv - Bioengineering 2020Quote: ... We Used the StepOnePlus Real-Time PCR System™ (Thermo Fisher Scientific). For transcript quantification ...
-
bioRxiv - Neuroscience 2021Quote: ... Using a QuantStudio 5 Real-Time PCR System (Applied Biosystems, Carlsbad, CA), mRNA expression was then determined by quantitative real-time polymerase chain reaction (qRT-PCR ...
-
bioRxiv - Neuroscience 2021Quote: ... A Real Time PCR System (Applied Biosystems/Thermo Fisher Art. No. 4376600) was used for qRT-PCR ...
-
bioRxiv - Neuroscience 2021Quote: ... A Real Time PCR System (Applied Biosystems/Thermo Fisher Art. No. 4376600) was used for qRT-PCR ...
-
bioRxiv - Neuroscience 2021Quote: ... or a QuantStudio 6 Flex Real-time PCR system (Applied Biosystems, USA). For qRT-PCR ...
-
bioRxiv - Neuroscience 2021Quote: ... Readout was performed with ViiA7 Real Time PCR systems (Thermo Fisher Scientific). As internal controls ...
-
bioRxiv - Neuroscience 2020Quote: ... qPCR was performed using the 7300 Real-Time PCR System (Applied Biosystems) and the hydrolyzed probe-based TaqMan chemistry ...
-
bioRxiv - Cell Biology 2021Quote: ... on a ViiA7 Real-Time PCR machine (Applied Biosystems, Foster City, California) and normalized to the Actb housekeeping gene.
-
bioRxiv - Cell Biology 2021Quote: ... and then carried out on the 7500 Real-Time PCR system (ThermoFisher) using LightCycler 480 software.
-
bioRxiv - Cancer Biology 2020Quote: ... Agilent 2100 Bioanaylzer and ABI StepOnePlus Real-Time PCR System (Applied Biosystems) were used in quantification and qualification of the sample libraries ...
-
bioRxiv - Cancer Biology 2020Quote: ... on an Applied Biosystems StepOnePlus real-time PCR machine (Thermo Fisher Scientifc). For analysis ...